WARNING: This summary was generated by AI. MIR506, a noncoding RNA, is implicated in various biological processes and diseases, including primary biliary cholangitis (PBC), pancreatic ductal adenocarcinoma (PDAC), acute T-cell leukemia (TALL), and adrenocortical carcinoma (ACC) [PMC8147992; PMC9312874; PMC7477680;'>PMC7477680; PMC5764399].'>PMC5764399].. In PBC patients, MIR506 is upregulated in the intrahepatic bile ducts and influences the secretion of biliary epithelial cells by targeting AE2 [PMC8147992]. Although MIR506's interaction with miR124 is not a contributing factor to miR124T's effect on astrocytic cells [PMC5476465], its overexpression in Jurkat cells has been shown to regulate BCL2 gene expression, suggesting a role in apoptosis regulation [PMC7477680]. Additionally, low expression of MIR506 may lead to increased CDK6 and CTNNB1 mRNA levels in ACCs [PMC5764399], while its role extends to the modulation of reactive oxygen species in various cancers including lung cancer (LC) [PMC9442502]. The statement regarding MIR506 in wheat and its predicted target genes such as AB182944 has been removed due to lack of supporting evidence in the provided references.
caucagccaua - --g c A UA A u
gccaccac cuaugu gua ugc uUAUUCAGGA GGUGU CUUA uagau a
|||||||| |||||| ||| ||| |||||||||| ||||| |||| |||||
cgguggug gguaca cgu aug GAUGAGUCUU CCACG GAAU guuua a
--uuuacaaca a gua A C -- - u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002878 |
| Description | Homo sapiens hsa-miR-506-3p mature miRNA |
| Sequence | 71 - UAAGGCACCCUUCUGAGUAGA - 91 |
| Evidence |
experimental
array-cloned [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022701 |
| Description | Homo sapiens hsa-miR-506-5p mature miRNA |
| Sequence | 35 - UAUUCAGGAAGGUGUUACUUAA - 56 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|