miRBase entry: hsa-mir-510

Stem-loop hsa-mir-510


Accession
MI0003197
Symbol
HGNC: MIR510
Description
Homo sapiens hsa-mir-510 precursor miRNA mir-509
Gene
family?
RF04216; mir-509

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR510 is a microRNA (miRNA) whose molecular functions are not well understood, and it is one of several candidate genes with differential methylation sites in their promoter regions [PMC8441705]. It was identified among novel miRNA families in wheat, suggesting a potential role in plant biology [PMC5360763]. A single nucleotide polymorphism (SNP) within MIR510 can affect the production of mature miRNA, with certain SNPs leading to increased or decreased levels [PMC7113310][PMC9708458[PMC9708458]. In the context of human health, MIR510 expression has been correlated with relapse-free survival (RFS) in patients, where high levels are associated with a poorer prognosis [PMC5362709]. It has been implicated as an oncomiR that promotes tumor growth in breast cancer and is considered a significant predictor of aggressive disease course [PMC5362709]. Additionally, MIR510 was found to be upregulated in regulatory T cells from individuals with type 1 diabetes (T1D), indicating its involvement in immune regulation [PMC7731293]. Moreover, mutations within the mature coding region of MIR510 have been identified both in patients and control samples, suggesting its potential role in various conditions [PMC2699475][PMC4883715[PMC4883715].

Literature search
40 open access papers mention hsa-mir-510
(235 sentences)

Sequence

1578 reads, 21.0 reads per million, 29 experiments
gugguguccUACUCAGGAGAGUGGCAAUCACAUguaauuaggugUGAUUGAAACCUCUAAGAGUGGAguaacac
(((...(((.((((.((((.((..(((((((((........)))))))))..))))))..)))))))....)))

Structure
   -gug   U    -A    A  GG         gua 
gug    ucc ACUC  GGAG GU  CAAUCACAU   a
|||    ||| ||||  |||| ||  |||||||||    
cac    AGG UGAG  UCUC CA  GUUAGUgug   u
   aaug   -    AA    -  AA         gau 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chrX: 147272335-147272408 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-510
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-510 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-510-5p

Accession MIMAT0002882
Description Homo sapiens hsa-miR-510-5p mature miRNA
Sequence 10 - UACUCAGGAGAGUGGCAAUCACAU - 33
Evidence experimental
array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-510-3p

Accession MIMAT0026613
Description Homo sapiens hsa-miR-510-3p mature miRNA
Sequence 45 - UGAUUGAAACCUCUAAGAGUGGA - 67
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15965474
    Identification of hundreds of conserved and nonconserved human microRNAs
    "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
    "Nat Genet (2005) 37:766-770

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45