Stem-loop hsa-mir-510

Accession

MI0003197

Symbol

HGNC: MIR510

Description

Homo sapiens hsa-mir-510 precursor miRNA mir-509

Gene
family

RF04216; mir-509

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR510 is a microRNA (miRNA) whose molecular functions are not well understood, and it is one of several candidate genes with differential methylation sites in their promoter regions [PMC8441705]. It was identified among novel miRNA families in wheat, suggesting a potential role in plant biology [PMC5360763]. A single nucleotide polymorphism (SNP) within MIR510 can affect the production of mature miRNA, with certain SNPs leading to increased or decreased levels [PMC7113310][PMC9708458[PMC9708458]. In the context of human health, MIR510 expression has been correlated with relapse-free survival (RFS) in patients, where high levels are associated with a poorer prognosis [PMC5362709]. It has been implicated as an oncomiR that promotes tumor growth in breast cancer and is considered a significant predictor of aggressive disease course [PMC5362709]. Additionally, MIR510 was found to be upregulated in regulatory T cells from individuals with type 1 diabetes (T1D), indicating its involvement in immune regulation [PMC7731293]. Moreover, mutations within the mature coding region of MIR510 have been identified both in patients and control samples, suggesting its potential role in various conditions [PMC2699475][PMC4883715[PMC4883715].

Literature search

15 open access papers mention hsa-mir-510
(144 sentences)

Sequence

1421 reads, 98 reads per million, 25 experiments

gugguguccUACUCAGGAGAGUGGCAAUCACauguaauuaggugugAUUGAAACCUCUAAGAGUGGAguaacac
(((...(((.((((.((((.((..(((((((((........)))))))))..))))))..)))))))....)))

Structure

   -gug   U    -A    A  GG         gua 
gug    ucc ACUC  GGAG GU  CAAUCACau   a
|||    ||| ||||  |||| ||  |||||||||    
cac    AGG UGAG  UCUC CA  GUUAgugug   u
   aaug   -    AA    -  AA         gau 

Annotation confidence High

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

chrX: 147272335-147272408 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-510

Disease association

hsa-mir-510 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-510-5p

• Accession: MIMAT0002882
• Description: Homo sapiens hsa-miR-510-5p mature miRNA
• Sequence: 10 - UACUCAGGAGAGUGGCAAUCAC - 31
• Evidence: experimental ; array-cloned [1], cloned [2], Illumina [3]

Mature hsa-miR-510-3p

• Accession: MIMAT0026613
• Description: Homo sapiens hsa-miR-510-3p mature miRNA
• Sequence: 47 - AUUGAAACCUCUAAGAGUGGA - 67
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 15965474
   Identification of hundreds of conserved and nonconserved human microRNAs
   "Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z"
   "Nat Genet (2005) 37:766-770


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45