WARNING: This summary was generated by AI. MIR510 is a microRNA (miRNA) whose molecular functions are not well understood, and it is one of several candidate genes with differential methylation sites in their promoter regions [PMC8441705]. It was identified among novel miRNA families in wheat, suggesting a potential role in plant biology [PMC5360763]. A single nucleotide polymorphism (SNP) within MIR510 can affect the production of mature miRNA, with certain SNPs leading to increased or decreased levels [PMC7113310][PMC9708458[PMC9708458]. In the context of human health, MIR510 expression has been correlated with relapse-free survival (RFS) in patients, where high levels are associated with a poorer prognosis [PMC5362709]. It has been implicated as an oncomiR that promotes tumor growth in breast cancer and is considered a significant predictor of aggressive disease course [PMC5362709]. Additionally, MIR510 was found to be upregulated in regulatory T cells from individuals with type 1 diabetes (T1D), indicating its involvement in immune regulation [PMC7731293]. Moreover, mutations within the mature coding region of MIR510 have been identified both in patients and control samples, suggesting its potential role in various conditions [PMC2699475][PMC4883715[PMC4883715].
-gug U -A A GG gua gug ucc ACUC GGAG GU CAAUCACau a ||| ||| |||| |||| || ||||||||| cac AGG UGAG UCUC CA GUUAgugug u aaug - AA - AA gau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0002882 |
| Description | Homo sapiens hsa-miR-510-5p mature miRNA |
| Sequence | 10 - UACUCAGGAGAGUGGCAAUCAC - 31 |
| Evidence |
experimental
array-cloned [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026613 |
| Description | Homo sapiens hsa-miR-510-3p mature miRNA |
| Sequence | 47 - AUUGAAACCUCUAAGAGUGGA - 67 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|