WARNING: This summary was generated by AI. MIR551B is a microRNA implicated in gene regulation, and its potential targets were investigated using computational tools [PMC6563032]. The analysis, employing algorithms like miRanda and Targetscan, suggested that MIR551B might interact with the 3′-UTR of the transcription factor ZEB1 [PMC6563032]. Furthermore, the possibility that MIR551B could also activate gene expression by acting on the promoters of certain genes was not ruled out [PMC6563032].
agaugugc c ca C --GAGA gug
ucuc uggcc uGAAAUCAAG GUGGGU CCug c
|||| ||||| |||||||||| |||||| ||||
agag gucgg ACUUUGGUUC UACCCA gggc a
----aaua u aG A GCGgaa aag
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004794 |
| Description | Homo sapiens hsa-miR-551b-5p mature miRNA |
| Sequence | 22 - GAAAUCAAGCGUGGGUGAGACC - 43 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0003233 |
| Description | Homo sapiens hsa-miR-551b-3p mature miRNA |
| Sequence | 61 - GCGACCCAUACUUGGUUUCAG - 81 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
|