Stem-loop hsa-mir-570

Accession

MI0003577

Symbol

HGNC: MIR570

Description

Homo sapiens hsa-mir-570 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR570 is a microRNA that has been implicated in various biological processes and diseases. It has been identified as one of the top features in a classification model that achieved a high accuracy of 0.9 [PMC9589260]. In the context of right ventricular hypertrophy (VH), circRNA-0068481 has been found to regulate the expression of MIR570, promoting the pathological progression of VH [PMC9589260]. MIR570 is also closely related to heart failure, as it is one of 13 genes identified in a study investigating HF [PMC9589260]. In terms of ceRNA axes, MIR570 is involved in interactions with two DElncRNAs and seven miRNAs [PMC9671706]. Additionally, MIR570 expression can be induced by hypoxia in a HIF-dependent manner [PMC8760265]. The rs4143815 variant of MIR570 has been associated with protection against multibacillary (MB) leprosy and decreased expression according to the GTEx database [PMC9503809]. Furthermore, MIR570 can regulate the expression of chemokines CCL4 and CCL5, indicating its involvement in inflammatory regulation [PMC9503809]. Genetic variants in miRNA genes including MIR570 have also been associated with leprosy risk and its different forms [PMC9503809]. In various diseases such as Parkinson's disease and cancer, including hepatocellular carcinoma and colon cancer, MIR570 has been implicated as a potential biomarker or regulator [PMC7523356][PMC4822961][PMC7529545][PMC8640083][PMC7816704[PMC4822961][PMC7529545][PMC8640083][PMC7816704].

Literature search

17 open access papers mention hsa-mir-570
(79 sentences)

Sequence

1961 reads, 83 reads per million, 70 experiments

cuagauaaguuauuaggugggugcAAAGGUAAUUGCAGUUUUUCCCauuauuuuaauugCGAAAACAGCAAUUACCUUUGCaccaaccugauggagu
.........(((((((((.(((((((((((((((((.((((((.(.((((...)))).).)))))).))))))))))))))))).)))))))))...

Structure

cuagauaag         g                 A      C C    u 
         uuauuaggu ggugcAAAGGUAAUUGC GUUUUU C auua  
         ||||||||| ||||||||||||||||| |||||| | |||| u
         gguagucca ccaCGUUUCCAUUAACG CAAAAG g uaau  
------uga         a                 A      C u    u 

Annotation confidence Not enough data

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr3: 195699401-195699497 [+]

Disease association

hsa-mir-570 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-570-3p

• Accession: MIMAT0003235
• Description: Homo sapiens hsa-miR-570-3p mature miRNA
• Sequence: 60 - CGAAAACAGCAAUUACCUUUGC - 81
• Evidence: experimental ; SAGE [1], cloned [2]

Mature hsa-miR-570-5p

• Accession: MIMAT0022707
• Description: Homo sapiens hsa-miR-570-5p mature miRNA
• Sequence: 25 - AAAGGUAAUUGCAGUUUUUCCC - 46
• Evidence: not_experimental

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692