miRBase entry: hsa-mir-579

Stem-loop hsa-mir-579


Accession
MI0003586
Symbol
HGNC: MIR579
Description
Homo sapiens hsa-mir-579 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR579 is a microRNA (miRNA) that has been implicated in various physiological and pathological processes, including cardiotoxicity and noradrenergic signaling. Elevated levels of MIR579 have been specifically associated with cardiotoxicity in patients treated with bevacizumab, a phenomenon that is not replicated by artificially engineering a CNNC motif into MIR579 [PMC7578723][PMC5340965[PMC5340965]. The MIR579 gene is located within the putative promoter region upstream of the gene and has been linked to the regulation of several genes involved in fear and anxiety [PMC6195525]. Notably, the minor (T)-allele of rs2910931 upstream of MIR579 has been associated with increased expression of hsa-miR-579-3p, leading to more effective repression of SLC6A2 expression and higher synaptic noradrenaline levels [PMC6195525]. This genetic variation may contribute to higher trait anxiety and panic disorder (PD) susceptibility due to increased sympathetic noradrenergic arousal [PMC6195525]. Additionally, MIR579's role in diabetic microvascular complications has been highlighted, where its inhibition leads to increased expression of protective vascular factors [PMC8631471][PMC9563036[PMC9563036]. Conservation studies have confirmed the presence of MIR579 among several primate species but not in more distantly related species such as mice or rats, limiting validation studies to primate models [PMC6195525].

Literature search
16 open access papers mention hsa-mir-579
(53 sentences)

Sequence

1159 reads, 9 reads per million, 73 experiments
cauauuagguuaaugcaaaaguaaUCGCGGUUUGUGCCAGAUGACGauuugaauuaauaaaUUCAUUUGGUAUAAACCGCGAUUauuuuugcaucaac
........(((.((((((((((((((((((((((((((((((((..(((((......))))))))))))))))))))))))))))))))))))).)))

Structure
cauauuag   a                                CG     aa 
        guu augcaaaaguaaUCGCGGUUUGUGCCAGAUGA  auuug  u
        ||| ||||||||||||||||||||||||||||||||  |||||   
        caa uacguuuuuaUUAGCGCCAAAUAUGGUUUACU  Uaaau  u
--------   c                                --     aa 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr5: 32394378-32394475 [-]

Disease association
hsa-mir-579 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-579-3p

Accession MIMAT0003244
Description Homo sapiens hsa-miR-579-3p mature miRNA
Sequence 62 - UUCAUUUGGUAUAAACCGCGAUU - 84
Evidence experimental
SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-579-5p

Accession MIMAT0026616
Description Homo sapiens hsa-miR-579-5p mature miRNA
Sequence 25 - UCGCGGUUUGUGCCAGAUGACG - 46
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45