WARNING: This summary was generated by AI. MIR579 is a microRNA (miRNA) that has been implicated in various physiological and pathological processes, including cardiotoxicity and noradrenergic signaling. Elevated levels of MIR579 have been specifically associated with cardiotoxicity in patients treated with bevacizumab, a phenomenon that is not replicated by artificially engineering a CNNC motif into MIR579 [PMC7578723][PMC5340965[PMC5340965]. The MIR579 gene is located within the putative promoter region upstream of the gene and has been linked to the regulation of several genes involved in fear and anxiety [PMC6195525]. Notably, the minor (T)-allele of rs2910931 upstream of MIR579 has been associated with increased expression of hsa-miR-579-3p, leading to more effective repression of SLC6A2 expression and higher synaptic noradrenaline levels [PMC6195525]. This genetic variation may contribute to higher trait anxiety and panic disorder (PD) susceptibility due to increased sympathetic noradrenergic arousal [PMC6195525]. Additionally, MIR579's role in diabetic microvascular complications has been highlighted, where its inhibition leads to increased expression of protective vascular factors [PMC8631471][PMC9563036[PMC9563036]. Conservation studies have confirmed the presence of MIR579 among several primate species but not in more distantly related species such as mice or rats, limiting validation studies to primate models [PMC6195525].
cauauuag a CG aa
guu augcaaaaguaaUCGCGGUUUGUGCCAGAUGA auuug u
||| |||||||||||||||||||||||||||||||| |||||
caa uacguuuuuaUUAGCGCCAAAUAUGGUUUACU Uaaau u
-------- c -- aa
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003244 |
| Description | Homo sapiens hsa-miR-579-3p mature miRNA |
| Sequence | 62 - UUCAUUUGGUAUAAACCGCGAUU - 84 |
| Evidence |
experimental
SAGE [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026616 |
| Description | Homo sapiens hsa-miR-579-5p mature miRNA |
| Sequence | 25 - UCGCGGUUUGUGCCAGAUGACG - 46 |
| Evidence |
experimental
Illumina [3] |
| Database links |
|
| Predicted targets |
|
|