miRBase entry: hsa-mir-597

Stem-loop hsa-mir-597


Accession
MI0003609
Symbol
HGNC: MIR597
Description
Homo sapiens hsa-mir-597 precursor miRNA mir-597
Gene
family?
RF00973; mir-597

Literature search
4 open access papers mention hsa-mir-597
(8 sentences)

Sequence

325 reads, 3 reads per million, 56 experiments
uacuuacucuacgugUGUGUCACUCGAUGACCACUGUgaagacaguaaaauguacagUGGUUCUCUUGUGGCUCAAGCGUaauguagaguacugguc
.(((((((((((((.((((((((..((.(((((((((....(((......)))))))))))).))..)))))....)))..))))))))))..))).

Structure
u   --          -g   ----     UC  U         gaag   gu 
 acu  uacucuacgu  UGU    GUCAC  GA GACCACUGU    aca  a
 |||  ||||||||||  |||    |||||  || |||||||||    |||   
 ugg  augagaugua  GCG    CGGUG  CU UUGGUgaca    ugu  a
c   uc          aU   AACU     UU  C         ----   aa 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr8: 9741672-9741768 [+]

Disease association
hsa-mir-597 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-597-5p

Accession MIMAT0003265
Description Homo sapiens hsa-miR-597-5p mature miRNA
Sequence 16 - UGUGUCACUCGAUGACCACUGU - 37
Evidence experimental
SAGE [1], cloned [2], Illumina [3]

Mature hsa-miR-597-3p

Accession MIMAT0026619
Description Homo sapiens hsa-miR-597-3p mature miRNA
Sequence 58 - UGGUUCUCUUGUGGCUCAAGCGU - 80
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45