Stem-loop hsa-mir-598

Accession

MI0003610

Symbol

HGNC: MIR598

Description

Homo sapiens hsa-mir-598 precursor miRNA mir-598

Gene
family

RF01059; mir-598

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR598 is a microRNA gene implicated in various biological processes and diseases, including neuropsychiatric disorders and cancer [PMC7947009, PMC6287550].'>PMC6287550].. In the context of 8p23.1 duplication syndrome, MIR598 is one of the genes located in the core duplicated interval and has been suggested to potentially contribute to autism spectrum disorder in patients with this syndrome [PMC7947009]. Research has indicated that MIR598 plays a role in inhibiting metastasis in colorectal cancer (CRC) by suppressing the JAG1–Notch2 pathway, but it does not stimulate epithelial–mesenchymal transition (EMT); instead, it suppresses EMT by inhibiting the Notch pathway alongside miR34a [PMC6287550, PMC7602903].'>PMC7602903].. Additionally, MIR598 is involved in regulating key oncogenes such as cMyc, K-Ras, and KLF4 [PMC7602903]. One study identified a unigene predicted to be miRNA MIR598 that did not include the sequence of mature miRNA MIR598, leading to its reclassification as an unknown messenger-like non-coding RNA [PMC3667022]. Moreover, MIR598 is considered one of several microRNAs that might contribute to compromised neurocognition associated with 8p23.1 duplication syndrome [PMC4268894].

Literature search

14 open access papers mention hsa-mir-598
(27 sentences)

Sequence

190577 reads, 393 reads per million, 107 experiments

gcuugaugaugcugcugaugcugGCGGUGAUCCCGAUGGUGUGAGCuggaaauggggugcUACGUCAUCGUUGUCAUCGUCAucaucaucauccgag
.((((((((......(((((.((((((((((..((((((((((.(((........)))..))))))))))..)))))))))).))))))))).))))

Structure

g    -    ugcugc     c          CC          -A   gga 
 cuug auga      ugaug ugGCGGUGAU  CGAUGGUGUG  GCu   a
 |||| ||||      ||||| ||||||||||  ||||||||||  |||    
 gagc uacu      acuac ACUGCUACUG  GCUACUGCAU  ugg   a
-    c    ------     u          UU          cg   ggu 

Annotation confidence High

Genome context

chr8: 11035206-11035302 [-]

Disease association

hsa-mir-598 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-598-3p

• Accession: MIMAT0003266
• Description: Homo sapiens hsa-miR-598-3p mature miRNA
• Sequence: 61 - UACGUCAUCGUUGUCAUCGUCA - 82
• Evidence: experimental ; Microarray [1], SAGE [1], cloned [2], Illumina [3]

Mature hsa-miR-598-5p

• Accession: MIMAT0026620
• Description: Homo sapiens hsa-miR-598-5p mature miRNA
• Sequence: 24 - GCGGUGAUCCCGAUGGUGUGAGC - 46
• Evidence: experimental ; Illumina [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45