MIR598 is a microRNA gene implicated in various biological processes and diseases, including neuropsychiatric disorders and cancer [PMC7947009, PMC6287550].'>PMC6287550].. In the context of 8p23.1 duplication syndrome, MIR598 is one of the genes located in the core duplicated interval and has been suggested to potentially contribute to autism spectrum disorder in patients with this syndrome [PMC7947009]. Research has indicated that MIR598 plays a role in inhibiting metastasis in colorectal cancer (CRC) by suppressing the JAG1–Notch2 pathway, but it does not stimulate epithelial–mesenchymal transition (EMT); instead, it suppresses EMT by inhibiting the Notch pathway alongside miR34a [PMC6287550, PMC7602903].'>PMC7602903].. Additionally, MIR598 is involved in regulating key oncogenes such as cMyc, K-Ras, and KLF4 [PMC7602903]. One study identified a unigene predicted to be miRNA MIR598 that did not include the sequence of mature miRNA MIR598, leading to its reclassification as an unknown messenger-like non-coding RNA [PMC3667022]. Moreover, MIR598 is considered one of several microRNAs that might contribute to compromised neurocognition associated with 8p23.1 duplication syndrome [PMC4268894].
g - ugcugc c CC -A gga cuug auga ugaug ugGCGGUGAU CGAUGGUGUG GCu a |||| |||| ||||| |||||||||| |||||||||| ||| gagc uacu acuac ACUGCUACUG GCUACUGCAU ugg a - c ------ u UU cg ggu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003266 |
| Description | Homo sapiens hsa-miR-598-3p mature miRNA |
| Sequence | 61 - UACGUCAUCGUUGUCAUCGUCA - 82 |
| Evidence |
experimental
Microarray [1], SAGE [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026620 |
| Description | Homo sapiens hsa-miR-598-5p mature miRNA |
| Sequence | 24 - GCGGUGAUCCCGAUGGUGUGAGC - 46 |
| Evidence |
experimental
Illumina [3] |
|