MIR605 is a microRNA that has been identified as a regulator of the p53-MDM2 interaction, acting as a transcriptional target of p53 and forming a positive feedback loop by degrading MDM2 [PMC3248149]. Overexpression of MIR605 has been shown to preferentially induce apoptosis over senescence [PMC3248149]. Despite its significant role in the p53 pathway, studies have not found statistical differences in the allelic and genotypic frequencies of MIR605 between congenital Zika syndrome (CZS) patients and control groups [PMC8294037]. Moreover, no alteration in MIR605 expression was observed in human neuroprogenitor cells (hNPCs) infected with Zika virus (ZIKV) [PMC8294037]. However, polymorphisms in the MIR605 gene have been associated with neurological toxicity during acute lymphoblastic leukemia (ALL) treatment, with one variant, rs2043556, showing significant correlation with toxicity risk and protective effects against infectious toxicities [PMC10003057]. This variant has also been linked to an increased risk of neurological toxicity during ALL treatment and is associated with various cancers [PMC10003057].
gc C CU gg ccuagcuugguucUAAAUC CAUGGUGCCUUCUC ug a ||||||||||||||||||| |||||||||||||| || a ggauugaacuaAGAUUUAG GUAUCACGGAAGAg ac a -- A -- aa
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003273 |
| Description | Homo sapiens hsa-miR-605-5p mature miRNA |
| Sequence | 16 - UAAAUCCCAUGGUGCCUUCUCCU - 38 |
| Evidence |
experimental
SAGE [1] |
| Accession | MIMAT0026621 |
| Description | Homo sapiens hsa-miR-605-3p mature miRNA |
| Sequence | 51 - AGAAGGCACUAUGAGAUUUAGA - 72 |
| Evidence |
experimental
Illumina [2] |
| Database links |
|
| Predicted targets |
|
|