miRBase entry: hsa-mir-609

Stem-loop hsa-mir-609


Accession
MI0003622
Symbol
HGNC: MIR609
Description
Homo sapiens hsa-mir-609 precursor miRNA

Literature search
6 open access papers mention hsa-mir-609
(8 sentences)

Sequence

7 reads, 0 reads per million, 5 experiments
ugcucggcuguuccuAGGGUGUUUCUCUCAUCUCUggucuauaauggguuaaauaguagagaugagggcaacacccuaggaacagcagaggaacc
(.(((.(((((((((((((((((.((((((((((((..((((..........)))))))))))))))).))))))))))))))))).))).)...

Structure
--- g   g                 U            gu    aaug 
   u cuc gcuguuccuAGGGUGUU CUCUCAUCUCUg  cuau    g
   | ||| ||||||||||||||||| ||||||||||||  ||||     
   a gag cgacaaggaucccacaa gggaguagagau  gaua    g
cca g   a                 c            --    aauu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 104218789-104218883 [-]

Disease association
hsa-mir-609 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-609

Accession MIMAT0003277
Description Homo sapiens hsa-miR-609 mature miRNA
Sequence 16 - AGGGUGUUUCUCUCAUCUCU - 35
Evidence experimental
SAGE [1]

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692