miRBase entry: hsa-mir-618

Stem-loop hsa-mir-618


Accession
MI0003632
Symbol
HGNC: MIR618
Description
Homo sapiens hsa-mir-618 precursor miRNA mir-618
Gene
family?
RF01034; mir-618

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR618 is a human microRNA gene located on chromosome 12 and is a single transcription product [PMC9495386], [PMC6706600]. Its function remains largely unexplored, and while it has been associated with lymphomagenesis, it has not been implicated in acting as a decoy for miR29; instead, HOTAIR has been identified with this function [PMC7215608], [PMC4695081]. The expression of miR-618, the small molecule product of MIR618, and its isomiRs can be influenced by the genetic variant rs2682818, which has been found to be more prevalent in idiopathic generalized epilepsy (IGE) patients compared to controls [PMC4695081]. MIR618 is situated within the first intron of the LIN7A gene, and its expression levels have been inversely correlated with hepatocellular carcinoma (HCC) differentiation, suggesting a potential role in cancer biology [PMC4695081]'>PMC4695081], [PMC3575633]. Despite attempts to identify differential gene expression in cells with mutant MIR618 compared to wild type cells using SAM analysis and small RNA sequencing, no significant differences have been found so far [PMC4695081].

Literature search
8 open access papers mention hsa-mir-618
(9 sentences)

Sequence

2894 reads, 22 reads per million, 55 experiments
cucuuguucacagccAAACUCUACUUGUCCUUCUGAGUguaauuacguacaugcaguagcucaggagacaagcagguuuacccuguggaugagucuga
..(((((((((((..((((.((.((((((.((((((((.....(((.........))))))))))))))))).))))))...))))))))))).....

Structure
---cu           -cc    U  A      C        guaau   gua 
     cuuguucacag   AAAC CU CUUGUC UUCUGAGU     uac   c
     |||||||||||   |||| || |||||| ||||||||     |||   a
     gaguagguguc   uuug ga gaacag aggacucg     aug   u
agucu           cca    -  c      -        -----   acg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 80935736-80935833 [-]

Disease association
hsa-mir-618 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-618

Accession MIMAT0003287
Description Homo sapiens hsa-miR-618 mature miRNA
Sequence 16 - AAACUCUACUUGUCCUUCUGAGU - 38
Evidence experimental
RT-PCR [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692