Stem-loop hsa-mir-618

Accession

MI0003632

Symbol

HGNC: MIR618

Description

Homo sapiens hsa-mir-618 precursor miRNA mir-618

Gene
family

RF01034; mir-618

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR618 is a small molecule composed of 98 nucleotides and is the single transcription product of MIR618, which is located on chromosome 12 [PMC6706600]. The function of MIR618 has not been extensively studied [PMC4695081]. The variant rs2682818 in MIR618 leads to increased expression of miR-618 and a different distribution of miR-618 isomiRs [PMC4695081]. The variant rs2682818 A>C in MIR618 is more frequently present in patients with idiopathic generalized epilepsy (IGE) compared to controls [PMC4695081]. MIR618 is located within the first intron of the gene LIN7A [PMC4695081'>PMC4695081]. Stable SH-SY5Y cells overexpressing wild type or mutant MIR618 were established to investigate the effect of the variant rs2682818 and the function of MIR618 [PMC4695081]. A miR-618 mimic transfected into HeLa cells, followed by RIP-Chip analysis and network analysis, indicated a potential role for MIR618 in lymphomagenesis [PMC4695081]. The expression levels of miR692, miR620, and MIR618 were found to be inversely correlated with the degree of hepatocellular carcinoma (HCC) differentiation [PMC3575633].

Literature search

8 open access papers mention hsa-mir-618
(9 sentences)

Sequence

2894 reads, 62 reads per million, 55 experiments

cucuuguucacagccAAACUCUACUUGUCCUUCUGAGUguaauuacguacaugcaguagcucaggagacaagcagguuuacccuguggaugagucuga
..(((((((((((..((((.((.((((((.((((((((.....(((.........))))))))))))))))).))))))...))))))))))).....

Structure

---cu           -cc    U  A      C        guaau   gua 
     cuuguucacag   AAAC CU CUUGUC UUCUGAGU     uac   c
     |||||||||||   |||| || |||||| ||||||||     |||   a
     gaguagguguc   uuug ga gaacag aggacucg     aug   u
agucu           cca    -  c      -        -----   acg 

Annotation confidence Not enough data

Genome context

chr12: 80935736-80935833 [-]

Disease association

hsa-mir-618 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-618

• Accession: MIMAT0003287
• Description: Homo sapiens hsa-miR-618 mature miRNA
• Sequence: 16 - AAACUCUACUUGUCCUUCUGAGU - 38
• Evidence: experimental ; RT-PCR [1], SAGE [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692