MIR618 is a small molecule composed of 98 nucleotides and is the single transcription product of MIR618, which is located on chromosome 12 [PMC6706600]. The function of MIR618 has not been extensively studied [PMC4695081]. The variant rs2682818 in MIR618 leads to increased expression of miR-618 and a different distribution of miR-618 isomiRs [PMC4695081]. The variant rs2682818 A>C in MIR618 is more frequently present in patients with idiopathic generalized epilepsy (IGE) compared to controls [PMC4695081]. MIR618 is located within the first intron of the gene LIN7A [PMC4695081'>PMC4695081]. Stable SH-SY5Y cells overexpressing wild type or mutant MIR618 were established to investigate the effect of the variant rs2682818 and the function of MIR618 [PMC4695081]. A miR-618 mimic transfected into HeLa cells, followed by RIP-Chip analysis and network analysis, indicated a potential role for MIR618 in lymphomagenesis [PMC4695081]. The expression levels of miR692, miR620, and MIR618 were found to be inversely correlated with the degree of hepatocellular carcinoma (HCC) differentiation [PMC3575633].
---cu -cc U A C guaau gua cuuguucacag AAAC CU CUUGUC UUCUGAGU uac c ||||||||||| |||| || |||||| |||||||| ||| a gaguagguguc uuug ga gaacag aggacucg aug u agucu cca - c - ----- acg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003287 |
Description | Homo sapiens hsa-miR-618 mature miRNA |
Sequence | 16 - AAACUCUACUUGUCCUUCUGAGU - 38 |
Evidence |
experimental
RT-PCR [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|