MIR618 is a human microRNA gene located on chromosome 12 and is a single transcription product [PMC9495386], [PMC6706600]. Its function remains largely unexplored, and while it has been associated with lymphomagenesis, it has not been implicated in acting as a decoy for miR29; instead, HOTAIR has been identified with this function [PMC7215608], [PMC4695081]. The expression of miR-618, the small molecule product of MIR618, and its isomiRs can be influenced by the genetic variant rs2682818, which has been found to be more prevalent in idiopathic generalized epilepsy (IGE) patients compared to controls [PMC4695081]. MIR618 is situated within the first intron of the LIN7A gene, and its expression levels have been inversely correlated with hepatocellular carcinoma (HCC) differentiation, suggesting a potential role in cancer biology [PMC4695081]'>PMC4695081], [PMC3575633]. Despite attempts to identify differential gene expression in cells with mutant MIR618 compared to wild type cells using SAM analysis and small RNA sequencing, no significant differences have been found so far [PMC4695081].
---cu -cc U A C guaau gua cuuguucacag AAAC CU CUUGUC UUCUGAGU uac c ||||||||||| |||| || |||||| |||||||| ||| a gaguagguguc uuug ga gaacag aggacucg aug u agucu cca - c - ----- acg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003287 |
Description | Homo sapiens hsa-miR-618 mature miRNA |
Sequence | 16 - AAACUCUACUUGUCCUUCUGAGU - 38 |
Evidence |
experimental
RT-PCR [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|