miRBase entry: hsa-mir-627

Stem-loop hsa-mir-627


Accession
MI0003641
Symbol
HGNC: MIR627
Description
Homo sapiens hsa-mir-627 precursor miRNA mir-627
Gene
family?
RF03831; mir-627

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR627 is a microRNA whose expression is influenced by the cellular environment, particularly under hypoxic conditions, as observed in hepatocellular carcinoma (HCC) cells [PMC8317525]. Research using ChIP assays with an H3K9ac antibody revealed that hypoxia leads to a decrease in H3 acetylation at the MIR627 promoter region, which correlates with the downregulation of MIR627 [PMC8317525]. This downregulation of MIR627 under hypoxia is dependent on HIF-1α; however, it does not occur through direct binding of HIF-1α to hypoxia-response elements (HRE) in the MIR627 promoter [PMC8317525]. Additionally, it was found that knockdown of HDAC3, an enzyme involved in histone deacetylation, results in increased acetylation and expression of MIR627, suggesting that HDAC3 plays a critical role in the repression of miR-627-5p during hypoxic conditions [PMC8317525'>PMC8317525]. Despite potential binding sites for HIF-1α on the MIR627 promoter region being identified and tested using ChIP and luciferase assays, no direct transcriptional activation by HIF-1α through these sites was observed [PMC8317525]. This indicates that miR-627-5p repression is mediated by mechanisms other than direct interaction with its promoter's HRE sites during hypoxia [PMC8317525].

Literature search
10 open access papers mention hsa-mir-627
(15 sentences)

Sequence

2946 reads, 103 reads per million, 96 experiments
uacuuauuacugguaGUGAGUCUCUAAGAAAAGAGGAggugguuguuuuccuccUCUUUUCUUUGAGACUCACUaccaauaauaagaaauacuacua
..(((((((.((((((((((((((.((((((((((((((.((....)).)))))))))))))).)))))))))))))).)))))))...........

Structure
---------ua       c              U              u  u 
           cuuauua ugguaGUGAGUCUC AAGAAAAGAGGAgg gg u
           ||||||| |||||||||||||| |||||||||||||| ||  
           gaauaau accaUCACUCAGAG UUCUUUUCUccucc uu g
aucaucauaaa       a              U              u  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 42199570-42199666 [-]

Disease association
hsa-mir-627 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-627-5p

Accession MIMAT0003296
Description Homo sapiens hsa-miR-627-5p mature miRNA
Sequence 16 - GUGAGUCUCUAAGAAAAGAGGA - 37
Evidence experimental
SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-627-3p

Accession MIMAT0026623
Description Homo sapiens hsa-miR-627-3p mature miRNA
Sequence 55 - UCUUUUCUUUGAGACUCACU - 74
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23226537
    The repertoire and features of human platelet microRNAs
    Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
    PLoS One (2012) 7:e50746