miRBase entry: hsa-mir-627

Stem-loop hsa-mir-627


Accession
MI0003641
Symbol
HGNC: MIR627
Description
Homo sapiens hsa-mir-627 precursor miRNA mir-627
Gene
family?
RF03831; mir-627

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR627 is a microRNA that is downregulated under hypoxic conditions, as shown by a ChIP assay using an antibody against H3K9ac (histone H3 acetylation) [PMC8317525]. The decreased acetylation of histone H3 across the MIR627 promoter region correlates with the downregulation of MIR627 expression [PMC8317525]. Conversely, the knockdown of HDAC3, a histone deacetylase, leads to increased acetylation levels and expression of MIR627 [PMC8317525]. The regulation of MIR627 by hypoxia is found to be HIF-1α-dependent but not through direct binding to the hypoxia response element (HRE) sites on the MIR627 gene promoter region [PMC8317525'>PMC8317525]. Additionally, it is shown that HDAC3-mediated histone deacetylation in the promoter region of MIR627 plays a critical role in hypoxia-mediated repression of miR-627-5p [PMC8317525]. ChIP assay using an antibody against H3K9ac confirms decreased histone H3 acetylation across the MIR627 promoter region under hypoxic conditions and this repression can be reversed by HDAC3 knockdown [PMC8317525]. Furthermore, it is noted that variants in the mature miRNA sequence can result in altered target specificity, as demonstrated by a variant in the seed sequence of MIR627 [PMC4756848].

Literature search
10 open access papers mention hsa-mir-627
(15 sentences)

Sequence

2946 reads, 103 reads per million, 96 experiments
uacuuauuacugguaGUGAGUCUCUAAGAAAAGAGGAggugguuguuuuccuccUCUUUUCUUUGAGACUCACUaccaauaauaagaaauacuacua
..(((((((.((((((((((((((.((((((((((((((.((....)).)))))))))))))).)))))))))))))).)))))))...........

Structure
---------ua       c              U              u  u 
           cuuauua ugguaGUGAGUCUC AAGAAAAGAGGAgg gg u
           ||||||| |||||||||||||| |||||||||||||| ||  
           gaauaau accaUCACUCAGAG UUCUUUUCUccucc uu g
aucaucauaaa       a              U              u  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr15: 42199570-42199666 [-]

Disease association
hsa-mir-627 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-627-5p

Accession MIMAT0003296
Description Homo sapiens hsa-miR-627-5p mature miRNA
Sequence 16 - GUGAGUCUCUAAGAAAAGAGGA - 37
Evidence experimental
SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-627-3p

Accession MIMAT0026623
Description Homo sapiens hsa-miR-627-3p mature miRNA
Sequence 55 - UCUUUUCUUUGAGACUCACU - 74
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23226537
    The repertoire and features of human platelet microRNAs
    Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
    PLoS One (2012) 7:e50746