MIR627 is a microRNA that is downregulated under hypoxic conditions, as shown by a ChIP assay using an antibody against H3K9ac (histone H3 acetylation) [PMC8317525]. The decreased acetylation of histone H3 across the MIR627 promoter region correlates with the downregulation of MIR627 expression [PMC8317525]. Conversely, the knockdown of HDAC3, a histone deacetylase, leads to increased acetylation levels and expression of MIR627 [PMC8317525]. The regulation of MIR627 by hypoxia is found to be HIF-1α-dependent but not through direct binding to the hypoxia response element (HRE) sites on the MIR627 gene promoter region [PMC8317525'>PMC8317525]. Additionally, it is shown that HDAC3-mediated histone deacetylation in the promoter region of MIR627 plays a critical role in hypoxia-mediated repression of miR-627-5p [PMC8317525]. ChIP assay using an antibody against H3K9ac confirms decreased histone H3 acetylation across the MIR627 promoter region under hypoxic conditions and this repression can be reversed by HDAC3 knockdown [PMC8317525]. Furthermore, it is noted that variants in the mature miRNA sequence can result in altered target specificity, as demonstrated by a variant in the seed sequence of MIR627 [PMC4756848].
---------ua c U u u cuuauua ugguaGUGAGUCUC AAGAAAAGAGGAgg gg u ||||||| |||||||||||||| |||||||||||||| || gaauaau accaUCACUCAGAG UUCUUUUCUccucc uu g aucaucauaaa a U u u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003296 |
Description | Homo sapiens hsa-miR-627-5p mature miRNA |
Sequence | 16 - GUGAGUCUCUAAGAAAAGAGGA - 37 |
Evidence |
experimental
SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026623 |
Description | Homo sapiens hsa-miR-627-3p mature miRNA |
Sequence | 55 - UCUUUUCUUUGAGACUCACU - 74 |
Evidence |
experimental
Illumina [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|