MIR33B is a small long-coding RNA that is constitutively under-expressed in multiple myeloma (MM) patients [PMC5721125]. Overexpression of MIR33B has been shown to inhibit tumor growth and increase survival in a human MM xenograft mice model [PMC5721125]. Under baseline conditions, oxLDL has been found to decrease the levels of MIR33B [PMC4945056]. However, pitavastatin has been shown to prevent the suppression of MIR33B by oxLDL [PMC4945056]. Silencing MIR33B has been found to reverse cordycepin-mediated suppression of invasive and migratory phenotypes in vitro and melanoma metastasis in vivo [PMC4496401]. Ixazomib treatment has been shown to induce upregulation of MIR33B in MM cells, leading to apoptosis by blocking the proto-oncogene PIM-1 [PMC7236745]. MIR33B is located in intron 17 of the SREBF-1 gene on chromosome 17 [PMC3639327]. Rodents lack the MIR33B gene in the SREBF-1 gene [PMC3639327]. Plasma levels of miR-33a and MIR33B have been found to be upregulated in familial hypercholesterolaemic children and positively correlated with LDL-C, LDL-C/HDL-C ratio, apolipoprotein B, CRP, and glycaemia [PMC5113745]. The transfer of MIR33B from MSCs to astrocytes through exosome-downregulated connected tissue growth factor expression can reduce glial scarring and promote neurite growth [PMC6038041]. Mentioned studies: [PMC5721125] - Study on microRNA profiling of MM cells treated with ixazomib [PMC4945056] - Study on the effect of oxLDL on miRNA levels [PMC4496401] - Study on the role of MIR33B in cordycepin-mediated suppression [PMC7236745] - Study on the effect of ixazomib treatment on MIR33B expression in MM cells [PMC3639327] - Study on the location of MIR33B in the SREBF-1 gene [PMC5113745] - Study on plasma levels of miR-33a and MIR33B in familial hypercholesterolaemic children [PMC6038041] - Study on the transfer of MIR33B from MSCs to astrocytes
----- --- - c c - UU g g gc gggc ggc ccg gG UGCAUUGCUG GCAUUGCac ugu u || |||| ||| ||| || |||||||||| ||||||||| ||| g cg cccg ccg ggC CC ACGUGACGGC CGUGACgug gcg a cacca guc g a - G UC g g
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0003301 |
Description | Homo sapiens hsa-miR-33b-5p mature miRNA |
Sequence | 16 - GUGCAUUGCUGUUGCAUUGC - 35 |
Evidence |
experimental
SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004811 |
Description | Homo sapiens hsa-miR-33b-3p mature miRNA |
Sequence | 54 - CAGUGCCUCGGCAGUGCAGCCC - 75 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|