miRBase entry: hsa-mir-641

Stem-loop hsa-mir-641


Accession
MI0003656
Symbol
HGNC: MIR641
Description
Homo sapiens hsa-mir-641 precursor miRNA mir-641
Gene
family?
RF03629; mir-641

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR641 is a microRNA implicated in the regulation of gene expression and has been associated with various cancers, including colorectal cancer [PMC2885343]. In the context of testicular germ cell cancer (TGCC), MIR641 has been shown to play a role in the pathogenesis by downregulating PTGDS gene expression following DMRT1 repression in human fetal testis [PMC6195803]. When human fetal testis tissue was transduced with MIR641, a reduction in DMRT1 protein levels was observed, particularly in second-trimester tissue, without affecting SOX9 expression [PMC6195803]. Additionally, MIR641 transduction resulted in a significant reduction of R-spondin 1 and SOX8 expression, indicating its influence on Sertoli cell-associated genes [PMC6195803]. However, due to considerable inter-individual variation between fetuses, no significant difference in DMRT1 gene expression was observed in tissues exposed to MIR641 when compared to scrambled miRNA-exposed control tissue [PMC6195803'>PMC6195803]. Moreover, exposure to MIR641 disrupted normal seminiferous cord structure within the testes [PMC6195803]. These findings suggest that MIR641 has functional significance within the human fetal testis by targeting genes associated with male reproductive development and may contribute to TGCC pathogenesis through its regulatory effects on DMRT1 and associated pathways [PMC6195803].

Literature search
10 open access papers mention hsa-mir-641
(32 sentences)

Sequence

5404 reads, 167 reads per million, 112 experiments
ugggugaaaggaaggAAAGACAUAGGAUAGAGUCACCUCuguccucuguccucuaccuauagaggugacuguccuaugucuuuccuuccucuuaccccu
.((((((.((((((((((((((((((((..((((((((((((.....(....).....)))))))))))))))))))))))))))))))).))))))..

Structure
-u      a                    AG            ccucu u 
  ggguga aggaaggAAAGACAUAGGAU  AGUCACCUCugu     g c
  |||||| ||||||||||||||||||||  ||||||||||||     |  
  cccauu uccuuccuuucuguauccug  ucaguggagaua     c c
uc      c                    --            uccau u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 40282543-40282641 [-]

Disease association
hsa-mir-641 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-641

Accession MIMAT0003311
Description Homo sapiens hsa-miR-641 mature miRNA
Sequence 16 - AAAGACAUAGGAUAGAGUCACCUC - 39
Evidence experimental
SAGE [1]
Database links
Predicted targets

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692