Stem-loop hsa-mir-641

Accession

MI0003656

Symbol

HGNC: MIR641

Description

Homo sapiens hsa-mir-641 precursor miRNA mir-641

Gene
family

RF03629; mir-641

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR641 is a microRNA that has been implicated in various biological processes and diseases [PMC2885343]. In the context of testicular germ cell cancer (TGCC), the down-regulation of MIR641 has been associated with the repression of the DMRT1 gene and a subsequent decrease in PTGDS gene expression in human fetal testis [PMC6195803]. In order to study the effects of MIR641 on DMRT1, first and second-trimester human fetal testis tissue was transduced with either MIR641, miR536 (another miRNA targeting DMRT1), or a scrambled control [PMC6195803]. The repression of DMRT1 was observed at the protein level in both trimesters, but only second-trimester tissue transduced with MIR641 showed a reduction in DMRT1 mRNA transcript level [PMC6195803]. Additionally, exposure to either miR536 or MIR641 resulted in a loss of DMRT1 protein expression in Sertoli cells [PMC6195803'>PMC6195803]. The study also found that R-spondin 1 expression was downregulated in tissue transduced with either miR536 or MIR641, while SOX8 expression was reduced following exposure to both miR536 and MIR641 [PMC6195803]. Furthermore, it was observed that knockdown of DMRT1 using either miR536 or MIR641 did not significantly affect inter-individual variation in DMRT gene expression [PMC6195803]. Overall, these findings suggest that MIR641 plays a role in TGCC pathogenesis through its regulation of DMRT1 and associated genes.

Literature search

10 open access papers mention hsa-mir-641
(32 sentences)

Sequence

5404 reads, 167 reads per million, 112 experiments

ugggugaaaggaaggAAAGACAUAGGAUAGAGUCACCUCuguccucuguccucuaccuauagaggugacuguccuaugucuuuccuuccucuuaccccu
.((((((.((((((((((((((((((((..((((((((((((.....(....).....)))))))))))))))))))))))))))))))).))))))..

Structure

-u      a                    AG            ccucu u 
  ggguga aggaaggAAAGACAUAGGAU  AGUCACCUCugu     g c
  |||||| ||||||||||||||||||||  ||||||||||||     |  
  cccauu uccuuccuuucuguauccug  ucaguggagaua     c c
uc      c                    --            uccau u 

Annotation confidence Not enough data

Genome context

chr19: 40282543-40282641 [-]

Disease association

hsa-mir-641 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-641

• Accession: MIMAT0003311
• Description: Homo sapiens hsa-miR-641 mature miRNA
• Sequence: 16 - AAAGACAUAGGAUAGAGUCACCUC - 39
• Evidence: experimental ; SAGE [1]

References

1. PubMed ID: 16505370
   The colorectal microRNAome
   "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
   "Proc Natl Acad Sci U S A (2006) 103:3687-3692