WARNING: This summary was generated by AI. MIR641 is a microRNA implicated in the regulation of gene expression and has been associated with various cancers, including colorectal cancer [PMC2885343]. In the context of testicular germ cell cancer (TGCC), MIR641 has been shown to play a role in the pathogenesis by downregulating PTGDS gene expression following DMRT1 repression in human fetal testis [PMC6195803]. When human fetal testis tissue was transduced with MIR641, a reduction in DMRT1 protein levels was observed, particularly in second-trimester tissue, without affecting SOX9 expression [PMC6195803]. Additionally, MIR641 transduction resulted in a significant reduction of R-spondin 1 and SOX8 expression, indicating its influence on Sertoli cell-associated genes [PMC6195803]. However, due to considerable inter-individual variation between fetuses, no significant difference in DMRT1 gene expression was observed in tissues exposed to MIR641 when compared to scrambled miRNA-exposed control tissue [PMC6195803'>PMC6195803]. Moreover, exposure to MIR641 disrupted normal seminiferous cord structure within the testes [PMC6195803]. These findings suggest that MIR641 has functional significance within the human fetal testis by targeting genes associated with male reproductive development and may contribute to TGCC pathogenesis through its regulatory effects on DMRT1 and associated pathways [PMC6195803].
-u a AG ccucu u ggguga aggaaggAAAGACAUAGGAU AGUCACCUCugu g c |||||| |||||||||||||||||||| |||||||||||| | cccauu uccUUCCUUUCUGUAUCCUG UCAGUggagaua c c uc c -- uccau u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003311 |
| Description | Homo sapiens hsa-miR-641-5p mature miRNA |
| Sequence | 16 - AAAGACAUAGGAUAGAGUCACCUC - 39 |
| Evidence |
experimental
SAGE [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0050510 |
| Description | Homo sapiens hsa-miR-641-3p mature miRNA |
| Sequence | 66 - UGACUGUCCUAUGUCUUUCCUU - 87 |
| Evidence |
experimental
SAGE [1] |
|