MIR641 is a microRNA that has been implicated in various biological processes and diseases [PMC2885343]. In the context of testicular germ cell cancer (TGCC), the down-regulation of MIR641 has been associated with the repression of the DMRT1 gene and a subsequent decrease in PTGDS gene expression in human fetal testis [PMC6195803]. In order to study the effects of MIR641 on DMRT1, first and second-trimester human fetal testis tissue was transduced with either MIR641, miR536 (another miRNA targeting DMRT1), or a scrambled control [PMC6195803]. The repression of DMRT1 was observed at the protein level in both trimesters, but only second-trimester tissue transduced with MIR641 showed a reduction in DMRT1 mRNA transcript level [PMC6195803]. Additionally, exposure to either miR536 or MIR641 resulted in a loss of DMRT1 protein expression in Sertoli cells [PMC6195803'>PMC6195803]. The study also found that R-spondin 1 expression was downregulated in tissue transduced with either miR536 or MIR641, while SOX8 expression was reduced following exposure to both miR536 and MIR641 [PMC6195803]. Furthermore, it was observed that knockdown of DMRT1 using either miR536 or MIR641 did not significantly affect inter-individual variation in DMRT gene expression [PMC6195803]. Overall, these findings suggest that MIR641 plays a role in TGCC pathogenesis through its regulation of DMRT1 and associated genes.
-u a AG ccucu u ggguga aggaaggAAAGACAUAGGAU AGUCACCUCugu g c |||||| |||||||||||||||||||| |||||||||||| | cccauu uccuuccuuucuguauccug ucaguggagaua c c uc c -- uccau u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003311 |
Description | Homo sapiens hsa-miR-641 mature miRNA |
Sequence | 16 - AAAGACAUAGGAUAGAGUCACCUC - 39 |
Evidence |
experimental
SAGE [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|