miRBase entry: hsa-mir-651

Stem-loop hsa-mir-651


Accession
MI0003666
Symbol
HGNC: MIR651
Description
Homo sapiens hsa-mir-651 precursor miRNA mir-651
Gene
family?
RF00972; mir-651

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR651 is a microRNA implicated in various genetic contexts, including a 1.69 Mb copy number gain at Xp22.31, which encompasses several genes and microRNAs [PMC4498854]. It is not mentioned as part of the 4.96 Mb loss on chromosome 6 but is included in the 1.69 Mb gain on chromosome X, suggesting its potential involvement in genomic structural variations [PMC4498854]. PolymiRTS analysis indicates that the C allele of rs149259359 may create novel binding sites for MIR651, among other miRNAs, which could influence gene regulation [PMC6969370]. Furthermore, MIR651 has been shown to correlate positively with serum levels of IP10 and MCP-1, two inflammatory markers associated with hepatocellular carcinoma (HCC) development, and this correlation was more pronounced in patients who developed HCC compared to controls [PMC9495750]. Additionally, MIR651 was found to interact with the long non-coding RNA LINC01106 along with other miRNAs, suggesting its role in complex regulatory networks that could be relevant to disease mechanisms or progression [PMC6714963].

Literature search
3 open access papers mention hsa-mir-651
(3 sentences)

Sequence

1816 reads, 90 reads per million, 114 experiments
aaucuaucacugcuuUUUAGGAUAAGCUUGACUUUUGuucaaauaaaaaugcaAAAGGAAAGUGUAUCCUAAAAGgcaaugacaguuuaauguguuu
...((.(((.((((((((((((((.((((..(((((((............)))))))..)))).)))))))))))))).))).))............

Structure
---------aau  a   c              A    GA       ucaaa 
            cu uca ugcuuUUUAGGAUA GCUU  CUUUUGu     u
            || ||| |||||||||||||| ||||  |||||||      
            ga agu acgGAAAAUCCUAU UGAA  GAAAacg     a
uuuguguaauuu  c   a              G    AG       uaaaa 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 8126965-8127061 [+]

Disease association
hsa-mir-651 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-651-5p

Accession MIMAT0003321
Description Homo sapiens hsa-miR-651-5p mature miRNA
Sequence 16 - UUUAGGAUAAGCUUGACUUUUG - 37
Evidence experimental
RT-PCR [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-651-3p

Accession MIMAT0026624
Description Homo sapiens hsa-miR-651-3p mature miRNA
Sequence 54 - AAAGGAAAGUGUAUCCUAAAAG - 75
Evidence experimental
Illumina [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45