miRBase entry: hsa-mir-652

Stem-loop hsa-mir-652


Accession
MI0003667
Symbol
HGNC: MIR652
Description
Homo sapiens hsa-mir-652 precursor miRNA mir-652
Gene
family?
RF00872; mir-652

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR652 is a microRNA that has been observed to have varying expression levels in different biological contexts and diseases. In the subgroup of early-onset myasthenia gravis (EOMG), MIR652 was found to be expressed at low levels [PMC3956820]. In contrast, in both knockout (KO) and knock-in (KI) mouse models, MIR652 was upregulated, which has been associated with the negative regulation of spermatid differentiation [PMC10001410]. In the case of breast cancer, MIR652 expression was generally lower in serum samples from cancer cases compared to controls [PMC9967215]. Furthermore, MIR652 has been identified as a potential biomarker for breast cancer in at least two independent clinical studies that analyzed serum, plasma, or whole blood samples [PMC9967215]. Kaplan-Meier analysis included MIR652 as part of a four-miRNA signature that could help predict tumor relapse and overall survival (OS) in patients with triple-negative breast cancer (TNBC), suggesting its potential prognostic value [PMC7392022].

Literature search
34 open access papers mention hsa-mir-652
(107 sentences)

Sequence

50720 reads, 199 reads per million, 123 experiments
acgaauggcuaugcacugcaCAACCCUAGGAGAGGGUGCCAUUCAcauagacuauaauugAAUGGCGCCACUAGGGUUGUGcagugcacaaccuacac
......((...((((((((((((((((((.....(((((((((((..((.....))..))))))))))).))))))))))))))))))...)).....

Structure
acgaau  cua                  GAGAG           ca  g 
      gg   ugcacugcaCAACCCUAG     GGUGCCAUUCA  ua a
      ||   ||||||||||||||||||     |||||||||||  || c
      cc   acgugacGUGUUGGGAUC     CCGCGGUAAgu  au u
-cacau  aac                  ----A           ua  a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 3' end of the miRNA is offset with respect to previous annotations. miR-652 cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context
chrX: 110055329-110055426 [+]

Disease association
hsa-mir-652 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-652-5p

Accession MIMAT0022709
Description Homo sapiens hsa-miR-652-5p mature miRNA
Sequence 21 - CAACCCUAGGAGAGGGUGCCAUUCA - 45
Evidence not_experimental
Database links
Predicted targets

Mature hsa-miR-652-3p

Accession MIMAT0003322
Description Homo sapiens hsa-miR-652-3p mature miRNA
Sequence 61 - AAUGGCGCCACUAGGGUUGUG - 81
Evidence experimental
Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692