MIR663A is a microRNA that has been found to suppress colorectal cancer (CC) metastasis [PMC6365692]. In contrast, TTC22V1 has been shown to promote CC metastasis [PMC6365692]. The significance of MIR663A downregulation by MALAT1 was evaluated by studying the expression changes of a set of MIR663A target genes, including P5319, PIK3CD12, P2111, CXCR413, TGFB120, and JUND21, in HCT116 cells [PMC6113222].
-ccuu c - -C G - ----- - ucg ccgg guc ccAGG GG GCG CCGCGGGA CCGCc c u |||| ||| ||||| || ||| |||||||| ||||| | ggcc cgg ggucc uu ugc ggcgcccu ggcgg g g guacc - u uu g c agggu u ucu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003326 |
Description | Homo sapiens hsa-miR-663a mature miRNA |
Sequence | 15 - AGGCGGGGCGCCGCGGGACCGC - 36 |
Evidence |
experimental
SAGE [1] |
Database links | |
Predicted targets |
|