MIR449B is a microRNA that is involved in various biological processes and diseases [PMC9855972]. It is a member of the miR-34/449 family, which consists of six homologous miRNAs encoded by three distinct loci [PMC9855972]. Following an ischemic injury to SVZ neural stem cells, the expression of MIR449B was found to change [PMC9405712]. Inhibition of MIR449B and knockdown of Notch1 attenuated the promotion of induced MIR449B [PMC9405712]. MIR449A, MIR449B, and miR449c are highly homologous [PMC6412851]. In HCC progression mediated by LM3 exosomes, six mRNAs containing binding sites for miR449a and/or MIR449B were detected [PMC6412851]. A common polymorphism in MIR449B was found to be protective against sight-threatening diabetic retinopathy (DR) and proliferative DR [PMC7683113]. Studies have identified miR-449a and MIR449B as microRNAs regulated by a specific transcription factor [PMC3756421]. Sperm-born MIR449B has been implicated in the regulation of the timing of the first cleavage in embryos produced through in vitro fertilization (IVF) and somatic cell nuclear transfer (SCNT) techniques [PMC5645405]. Additionally, a common polymorphism in MIR499B is associated with a decreased risk of sight-threatening DR in Caucasian patients with type 1 diabetes mellitus (T1DM) [PMC8421969].
---------uga u u A U UU A C u gu cc gaa caggu GGCAG GUA GUU G UGGCugcu gg c || ||| ||||| ||||| ||| ||| | |||||||| || gg cuu guUCA CCGUC CAU CAA C ACCGACga cu a ucuucuuaaaua u c - C -- - - - ga
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003327 |
Description | Homo sapiens hsa-miR-449b-5p mature miRNA |
Sequence | 16 - AGGCAGUGUAUUGUUAGCUGGC - 37 |
Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0009203 |
Description | Homo sapiens hsa-miR-449b-3p mature miRNA |
Sequence | 55 - CAGCCACAACUACCCUGCCACU - 76 |
Evidence |
experimental
454 [3] |
|