WARNING: This summary was generated by AI. MIR449B is a member of the miR-34/449 family, which includes six homologous microRNAs encoded by three distinct loci, playing a role in various cellular processes [PMC9855972]. Following ischemic injury to SVZ neural stem cells, MIR449B expression is altered, and its upregulation can be attenuated by both miR-449b inhibitor and Notch1 shRNA [PMC9405712]. MIR449B is highly homologous to miR449a and miR-449c [PMC6412851]'>PMC6412851], and it interacts with various genetic elements including pseudogenes, other microRNAs, and protein-coding genes [PMC9730017]. In the context of hepatocellular carcinoma (HCC), MIR449B has been implicated in the disease's progression through its binding sites found in mRNAs within cells treated with LM3 exosomes [PMC6412851]. Notably, a single nucleotide polymorphism (SNP) within MIR449B, rs10061133, has been identified as protective against sight-threatening diabetic retinopathy (DR) and proliferative DR [PMC7683113]. Additionally, sperm-born MIR449B appears to be involved in regulating the timing of the first cleavage during fertilization processes [PMC5645405], with a common polymorphism in MIR449B being significantly associated with decreased risk of proliferative DR in Caucasian patients with type 1 diabetes mellitus (T1DM) [PMC8421969].
---------uga u u A U UU A C u gu
cc gaa caggu GGCAG GUA GUU G UGGCugcu gg c
|| ||| ||||| ||||| ||| ||| | |||||||| ||
gg cuu guUCA CCGUC CAU CAA C ACCGACga cu a
ucuucuuaaaua u c - C -- - - - ga
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003327 |
| Description | Homo sapiens hsa-miR-449b-5p mature miRNA |
| Sequence | 16 - AGGCAGUGUAUUGUUAGCUGGC - 37 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0009203 |
| Description | Homo sapiens hsa-miR-449b-3p mature miRNA |
| Sequence | 55 - CAGCCACAACUACCCUGCCACU - 76 |
| Evidence |
experimental
454 [3] |
|