WARNING: This summary was generated by AI. MIR411 is a microRNA that has been implicated in various biological processes and diseases, including Alzheimer's disease (AD) and idiopathic pulmonary fibrosis (IPF) [PMC7564652]'>PMC7564652], [PMC9930250]. It is one of several miRNAs that are upregulated in diseased human bronchial epithelial cell-derived small extracellular vesicles (sEVs), although it is not a target of Drp1 but rather Drp1 is a target of MIR411, which is involved in mitochondrial dynamics [PMC9626984], [PMC9930250]. In the context of AD, MIR411 is downregulated in the cortex of patients, suggesting a potential role in the disease's pathogenesis; however, its specific function and targets within AD are not yet clear [PMC7564652]. Additionally, MIR411 has been found to be expressed at higher levels in fibroblasts compared to D492 breast epithelial cells and is one of the most differentially expressed miRNAs located on chromosome 8 in the dog reference genome CanFam3.1 [PMC7308478], [PMC8376273]. It has also been included as part of a microRNA model to distinguish lymph node metastasis (LNM) in colorectal cancer (CRC), indicating its potential utility as a biomarker for cancer progression [PMC9614158]. Furthermore, MIR411 is involved in anti-inflammatory processes as it was found to be expressed at high levels within bone marrow stem cell-derived exosomes which modulate inflammatory pathways [PMC7897935], [PMC9069372].
-------------- ug a A A AUA - uuu
ugguacu gag g UAGU GACCGU GCGUACG c a
||||||| ||| | |||| |||||| ||||||| | u
acuauga cuc C AUCA CUGGCA UGUAUgc g c
gagccccuaccuaa -- C A C CAA a ugu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003329 |
| Description | Homo sapiens hsa-miR-411-5p mature miRNA |
| Sequence | 15 - AUAGUAGACCGUAUAGCGUACG - 36 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004813 |
| Description | Homo sapiens hsa-miR-411-3p mature miRNA |
| Sequence | 51 - UAUGUAACACGGUCCACUAACC - 72 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|