MIR411 is a microRNA that has been shown to target Drp1 and is upregulated in DHBE cells compared to NHBE cells [PMC9626984]. Differential miRNA cargo within sEVs containing MIR411 may induce senescence in healthy epithelial cells and could be a potential target for therapeutics in idiopathic pulmonary fibrosis [PMC9930250]. In the context of Alzheimer's disease (AD), MIR411 is downregulated in the cortex of AD patients [PMC7564652]. MIR411 has been previously studied and reported in the brain tissue of AD patients [PMC7564652]. In fibroblasts, MIR411 has higher expression compared to its expression in D492 cells [PMC7308478]. Additionally, MIR411 is downregulated in AF+AVBvsCTL and AFvsCTL analyses [PMC8376273]. MIR411 is part of the miR655 cluster, which includes other miRNAs such as miR134, miR154, and miR655 [PMC10148110]. In colorectal cancer (CRC), MIR411 is one of five microRNAs that can distinguish lymph node metastasis [PMC9614158]. Furthermore, MIR411 is expressed in BMSC-derived exosomes and can modulate the NF-κB pathway to inhibit pro-inflammatory cytokine release [PMC7897935]. Along the Dlk1-Dio3 imprinted domain, which includes Mir136 and Mir127 along Rtl1as, Mir370 along Rian, Mir154 along Mirg, and other miRNAs such as MIR411 are transcribed from the maternal chromosome [PMC3919614]. Finally, a risk-prediction model for lymph node metastasis includes MIR411 as one of five associated microRNAs [PMC8593512].
-------------- ug a a A AUA - uuu ugguacu gag g UAGU GACCGU GCGUACG c a ||||||| ||| | |||| |||||| ||||||| | u acuauga cuc C AUCA CUGGCA UGUAUgc g c gagccccuaccuaa -- C A C CAA a ugu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003329 |
Description | Homo sapiens hsa-miR-411-5p mature miRNA |
Sequence | 16 - UAGUAGACCGUAUAGCGUACG - 36 |
Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0004813 |
Description | Homo sapiens hsa-miR-411-3p mature miRNA |
Sequence | 51 - UAUGUAACACGGUCCACUAACC - 72 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|