miRBase entry: hsa-mir-654

Stem-loop hsa-mir-654


Accession
MI0003676
Symbol
HGNC: MIR654
Description
Homo sapiens hsa-mir-654 precursor miRNA mir-654
Gene
family?
RF01922; mir-654

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR654 is a microRNA that has been found to be associated with various biological processes, including carcinogenesis [PMC9224266]. In ovarian cancer cells, the long non-coding RNA EMX2OS can directly bind to MIR654 and inhibit its expression, resulting in the upregulation of PD-L1 and the promotion of proliferation, invasion, and spheroid formation [PMC8974003]. However, MIR654 was not detected in head and neck cancers [PMC5354851]. Several studies have shown that MIR654 can inhibit the replication or propagation of influenza virus [PMC3774802]. Additionally, MIR654 has been found to bind to PB1 in MDCK cells and inhibit the replication of H1N1 virus [PMC5360757].

In a study on prognosis, 10 miRNAs were found to be associated with a good prognosis [PMC9924325]. Furthermore, four long non-coding RNAs (lncRNAs) and three miRNAs were found to regulate AZGP1 [PMC9924325].

Overall, MIR654 is a microRNA that plays a role in various biological processes including carcinogenesis. It can be regulated by long non-coding RNAs and has been shown to have inhibitory effects on influenza virus replication. However, its expression may vary depending on the type of cancer or infection.

Literature search
29 open access papers mention hsa-mir-654
(78 sentences)

Sequence

4784 reads, 83 reads per million, 85 experiments
ggguaaguggaaagaUGGUGGGCCGCAGAACAUGUGCugaguucgugccaUAUGUCUGCUGACCAUCACCUUuagaagccc
((((......((((.((((((.(.(((((.(((((((.........).))))))))))).).)))))).))))....))))

Structure
    aagugg    a      G C     A      - uga 
gggu      aaag UGGUGG C GCAGA CAUGUG C   g
||||      |||| |||||| | ||||| |||||| |   u
cccg      uUUC ACUACC G CGUCU GUAUac g   u
    --aaga    C      A U     -      c ugc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101040219-101040299 [+]
Clustered miRNAs
15 other miRNAs are < 10 kb from hsa-mir-654
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-654 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-654-5p

Accession MIMAT0003330
Description Homo sapiens hsa-miR-654-5p mature miRNA
Sequence 16 - UGGUGGGCCGCAGAACAUGUGC - 37
Evidence experimental
Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

Mature hsa-miR-654-3p

Accession MIMAT0004814
Description Homo sapiens hsa-miR-654-3p mature miRNA
Sequence 51 - UAUGUCUGCUGACCAUCACCUU - 72
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692