miRBase entry: hsa-mir-655

Stem-loop hsa-mir-655


Accession
MI0003677
Symbol
HGNC: MIR655
Description
Homo sapiens hsa-mir-655 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR655 is a microRNA that has recently been associated with the regulation of reactive oxygen species (ROS) production, marking the first time it has been linked to oxidative stress [PMC6720387]. This microRNA, along with miR526b, demonstrates increased expression levels during conditions of cellular oxidative stress, suggesting a role in the cellular response to such stress [PMC6720387]. Additionally, MIR655 is implicated in the upregulation of vascular endothelial growth factors (VEGFs) that are known to promote lymphangiogenesis; this process is believed to be induced by certain COX-2/EP4-related microRNAs, including MIR655 [PMC7956318].

Literature search
13 open access papers mention hsa-mir-655
(318 sentences)

Sequence

2163 reads, 13 reads per million, 74 experiments
aacuaugcaaggauauuugaggAGAGGUUAUCCGUGUUAUGUUCgcuucauucaucaugaAUAAUACAUGGUUAACCUCUUUuugaauaucagacuc
...........(((((((((((((((((((.((((((..((((((............))))))..)))))).)))))))))))))))))))......

Structure
aacuaugcaag                   U      UA      cuuca 
           gauauuugaggAGAGGUUA CCGUGU  UGUUCg     u
           ||||||||||||||||||| ||||||  ||||||      
           cuauaaguuUUUCUCCAAU GGUACA  AUAagu     u
-----cucaga                   U      UA      acuac 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101049550-101049646 [+]
Clustered miRNAs
19 other miRNAs are < 10 kb from hsa-mir-655
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-655 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-655-3p

Accession MIMAT0003331
Description Homo sapiens hsa-miR-655-3p mature miRNA
Sequence 61 - AUAAUACAUGGUUAACCUCUUU - 82
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-655-5p

Accession MIMAT0026626
Description Homo sapiens hsa-miR-655-5p mature miRNA
Sequence 23 - AGAGGUUAUCCGUGUUAUGUUC - 44
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45