MIR655 is a microRNA that has recently been associated with the regulation of reactive oxygen species (ROS) production, marking the first time it has been linked to oxidative stress [PMC6720387]. This microRNA, along with miR526b, demonstrates increased expression levels during conditions of cellular oxidative stress, suggesting a role in the cellular response to such stress [PMC6720387]. Additionally, MIR655 is implicated in the upregulation of vascular endothelial growth factors (VEGFs) that are known to promote lymphangiogenesis; this process is believed to be induced by certain COX-2/EP4-related microRNAs, including MIR655 [PMC7956318].
aacuaugcaag U UA cuuca
gauauuugaggAGAGGUUA CCGUGU UGUUCg u
||||||||||||||||||| |||||| ||||||
cuauaaguuUUUCUCCAAU GGUACA AUAagu u
-----cucaga U UA acuac
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003331 |
| Description | Homo sapiens hsa-miR-655-3p mature miRNA |
| Sequence | 61 - AUAAUACAUGGUUAACCUCUUU - 82 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026626 |
| Description | Homo sapiens hsa-miR-655-5p mature miRNA |
| Sequence | 23 - AGAGGUUAUCCGUGUUAUGUUC - 44 |
| Evidence |
experimental
Illumina [3] |
|