MIR656 is a microRNA (miRNA) that has been implicated in various cellular processes and diseases. It is part of the DLK1-DIO3 imprinted cluster and has been associated with sensitivity to bleomycin in renal cell carcinoma cell lines [PMC9716673]. Additionally, MIR656 is among the miRNAs that have been found to be upregulated in the progression of severe pneumonia, suggesting a potential role in this disease [PMC6090384]. It encodes miR-656, which, along with miR-449a encoded by MIR449A, has been identified as commonly upregulated genes potentially related to pneumonia [PMC6090384]. Despite its association with disease states, MIR656 was excluded from further investigation in a study on invasive adenocarcinoma due to the focus on candidates suitable for investigation by immunohistochemistry (IHC) [PMC6422190]. Moreover, MIR656 appears to be less expressed in multiple sclerosis (MS), indicating its involvement in the pathogenesis of this condition as well [PMC4655260]. In brain research related to learning and memory processes, MIR656 was identified as one of the miRNA-containing precursors that showed a significant decrease across different brain regions when comparing different learning states [PMC7848201].
----------cu u C A cuu u
gaaa AGGUUG CUGUG GGUGUUCA uc a
|||| |||||| ||||| |||||||| || u
cuuU UCCAAC GACAU UUAUAAgu ag a
cuaagcuauagc C U A --- u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003332 |
| Description | Homo sapiens hsa-miR-656-3p mature miRNA |
| Sequence | 43 - AAUAUUAUACAGUCAACCUCU - 63 |
| Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], Illumina [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026627 |
| Description | Homo sapiens hsa-miR-656-5p mature miRNA |
| Sequence | 8 - AGGUUGCCUGUGAGGUGUUCA - 28 |
| Evidence |
experimental
Illumina [2] |
|