miRBase entry: hsa-mir-656

Stem-loop hsa-mir-656


Accession
MI0003678
Symbol
HGNC: MIR656
Description
Homo sapiens hsa-mir-656 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR656 is a microRNA (miRNA) that has been implicated in various cellular processes and diseases. It is part of the DLK1-DIO3 imprinted cluster and has been associated with sensitivity to bleomycin in renal cell carcinoma cell lines [PMC9716673]. Additionally, MIR656 is among the miRNAs that have been found to be upregulated in the progression of severe pneumonia, suggesting a potential role in this disease [PMC6090384]. It encodes miR-656, which, along with miR-449a encoded by MIR449A, has been identified as commonly upregulated genes potentially related to pneumonia [PMC6090384]. Despite its association with disease states, MIR656 was excluded from further investigation in a study on invasive adenocarcinoma due to the focus on candidates suitable for investigation by immunohistochemistry (IHC) [PMC6422190]. Moreover, MIR656 appears to be less expressed in multiple sclerosis (MS), indicating its involvement in the pathogenesis of this condition as well [PMC4655260]. In brain research related to learning and memory processes, MIR656 was identified as one of the miRNA-containing precursors that showed a significant decrease across different brain regions when comparing different learning states [PMC7848201].

Literature search
12 open access papers mention hsa-mir-656
(38 sentences)

Sequence

375 reads, 21 reads per million, 61 experiments
cugaaauAGGUUGCCUGUGAGGUGUUCAcuuucuauaugaugAAUAUUAUACAGUCAACCUCUuuccgauaucgaauc
..((((.((((((.(((((.((((((((...((.....)))))))))).))))).)))))).))))............

Structure
----------cu    u      C     A        cuu  u 
            gaaa AGGUUG CUGUG GGUGUUCA   uc a
            |||| |||||| ||||| ||||||||   || u
            cuuU UCCAAC GACAU UUAUAAgu   ag a
cuaagcuauagc    C      U     A        ---  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101066724-101066801 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from hsa-mir-656
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-656 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-656-3p

Accession MIMAT0003332
Description Homo sapiens hsa-miR-656-3p mature miRNA
Sequence 43 - AAUAUUAUACAGUCAACCUCU - 63
Evidence experimental
Microarray [1], RT-PCR [1], SAGE [1], Illumina [2]
Database links
Predicted targets

Mature hsa-miR-656-5p

Accession MIMAT0026627
Description Homo sapiens hsa-miR-656-5p mature miRNA
Sequence 8 - AGGUUGCCUGUGAGGUGUUCA - 28
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45