MIR656 is a microRNA that has been implicated in various biological processes and diseases. It has been found to be associated with sensitivity to KIN001-236 in ovarian cell lines and bleomycin in renal cell carcinoma cell lines [PMC9716673]. Additionally, MIR656 has been identified as a potential gene associated with the progression of severe pneumonia [PMC6090384]. It is worth noting that MIR656, along with EIF5AP4, are novel genes that have not yet been reported to be related to pneumonia [PMC6090384]. MIR656 has also been identified as a gene that shows a significantly lower methylation rate in invasive adenocarcinoma relative to AIS [PMC6422190]. In the context of multiple sclerosis, MIR656 is one of the miRNAs that seem to be less expressed in the diseased context [PMC4655260]. Furthermore, MIR656 has shown decreased expression levels in certain brain regions compared to others [PMC7848201]. Overall, these findings suggest that MIR656 may play important roles in various biological processes and diseases.
----------cu u C A cuu u gaaa AGGUUG CUGUG GGUGUUCA uc a |||| |||||| ||||| |||||||| || u cuuU UCCAAC GACAU UUAUAAgu ag a cuaagcuauagc C U A --- u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003332 |
Description | Homo sapiens hsa-miR-656-3p mature miRNA |
Sequence | 43 - AAUAUUAUACAGUCAACCUCU - 63 |
Evidence |
experimental
Microarray [1], RT-PCR [1], SAGE [1], Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026627 |
Description | Homo sapiens hsa-miR-656-5p mature miRNA |
Sequence | 8 - AGGUUGCCUGUGAGGUGUUCA - 28 |
Evidence |
experimental
Illumina [2] |
|