miRBase entry: hsa-mir-421

Stem-loop hsa-mir-421


Accession
MI0003685
Symbol
HGNC: MIR421
Description
Homo sapiens hsa-mir-421 precursor miRNA mir-95
Gene
family?
RF04053; mir-95

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MicroRNA 421 (MIR421) is a non-coding RNA molecule that plays a significant role in various biological processes, including cancer progression and the body's response to oxidative stress [PMC7802300; PMC9313271].. In gastric cancer, MIR421 levels in gastric juice are notably different from those in benign gastric diseases [PMC6924079]. MIR421, along with MIR27a-3p and hemoglobin levels in feces, has been utilized to develop a model that accurately identifies patients with colorectal cancer (CRC), demonstrating superior diagnostic performance compared to fecal hemoglobin concentration alone [PMC9318064]. Additionally, MIR421 has been implicated in the negative regulation of the ACE2 receptor by targeting its 3′-UTR [PMC7653219], and its overexpression is associated with increased proliferation of cancer cells in breast and non-small cell lung cancers [PMC7802300]. Furthermore, MIR421 is part of a three-miRNA signature that predicts gastrointestinal (GI) involvement and clinical outcomes [PMC7802300]'>PMC7802300], and it has been shown to interfere with DNA repair by suppressing ataxia-telangiectasia mutated expression, thereby enhancing GI [PMC7802300]. Despite its oncogenic role in various cancers, MIR421 may also act as a tumor suppressor in certain contexts such as prostate cancer cells [PMC6089101], illustrating its complex role in oncogenesis.

Literature search
50 open access papers mention hsa-mir-421
(142 sentences)

Sequence

47198 reads, 206 reads per million, 104 experiments
gcacauuguaggccucauuaaauguuuguugaaugaaaaaaugaaucAUCAACAGACAUUAAUUGGGCGCcugcucugugaucuc
.((((..((((((((((...((((((((((((.(((.........)))))))))))))))...)))).))))))..)))).....

Structure
----g    uu      -    uua            a   aaa 
     caca  guaggc cuca   aauguuuguuga uga   a
     ||||  |||||| ||||   |||||||||||| |||   a
     gugu  cgucCG GGGU   UUACAGACAACU Acu   u
cucua    cu      C    UAA            -   aag 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 74218377-74218461 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-421
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-421 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-421

Accession MIMAT0003339
Description Homo sapiens hsa-miR-421 mature miRNA
Sequence 48 - AUCAACAGACAUUAAUUGGGCGC - 70
Evidence experimental
Microarray [1], SAGE [1], cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16505370
    The colorectal microRNAome
    "Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE"
    "Proc Natl Acad Sci U S A (2006) 103:3687-3692