MIR421 is a microRNA that has been studied in various diseases, including gastric cancer, colorectal cancer (CRC), breast cancer, vitiligo, and osteogenesis. In gastric cancer patients, the levels of MIR421 in gastric juice were significantly different compared to patients with benign gastric disease [PMC6924079]. In CRC, a model combining the fecal levels of MIR421, MIR27a-3p, and hemoglobin showed improved accuracy in identifying patients with CRC compared to fecal hemoglobin concentration alone [PMC9318064]. MIR421 has been shown to target a binding site in the 3'-UTR of ACE2 transcript and negatively regulate the receptor [PMC7653219]. It has also been implicated in promoting cancer cell proliferation in breast cancer and non-small cell lung cancer [PMC7802300]. In gastrointestinal (GI) cancers, including CRC and gastric cancer, a three-miRNA signature (miGISig) that includes MIR421 has been identified as predictive of GI and clinical outcome [PMC7802300]. Furthermore, MIR421 has been reported to cause the failure of DNA repair by suppressing the expression of ataxia-telangiectasia mutated (ATM), a core component of the DNA repair system [PMC7802300]. Additionally, MIR421 is associated with oxidative stress response in vitiligo and may play a regulatory role in osteogenesis by targeting BMP2 [PMC9313271] [PMC9753082]. In various cancers such as GC, HCC, PCa tumor tissues and nasopharyngeal carcinoma tumor tissues high expression of MIR421 is significantly associated with poor clinical outcomes. However it may play different roles depending on the type of tumor it is expressed on. It acts as an oncomiRNA promoting cell proliferation on GC,HCC PCa tumor tissues but it may play a tumor-suppressor role in prostate cancer cells [PMC6089101].
----g uu - uua a aaa caca guaggc cuca aauguuuguuga uga a |||| |||||| |||| |||||||||||| ||| a gugu cgucCG GGGU UUACAGACAACU Acu u cucua cu C UAA - aag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003339 |
Description | Homo sapiens hsa-miR-421 mature miRNA |
Sequence | 48 - AUCAACAGACAUUAAUUGGGCGC - 70 |
Evidence |
experimental
Microarray [1], SAGE [1], cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|