Stem-loop ebv-mir-BART3

Accession

MI0003725

Description

Epstein Barr virus ebv-mir-BART3 precursor miRNA

Sequence

ccuuugguggaACCUAGUGUUAGUGUUGUGCUguaaauaaguguccagCGCACCACUAGUCACCAGGUGUcaccggagg
((((((((((.((((.(((((((((.(((((((............))))))).)))))).))).)))).))))))))))

Structure

          a    A   -      U       uaaau 
ccuuuggugg ACCU GUG UUAGUG UGUGCUg     a
|||||||||| |||| ||| |||||| |||||||      
ggaggccacU UGGA CAC GAUCAC ACGCgac     a
          G    C   U      C       cugug 

Annotation confidence Not enough data

Comments

mir-BART3 was discovered independently by two groups. Cai et al identified mature miRNA products from both arms of the hairpin precursor and mapped the ends of the mature sequences by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

HHV507799: 139076-139154 [+]

Clustered miRNAs

20 other miRNAs are < 10 kb from ebv-mir-BART3

Disease association

ebv-mir-BART3 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART3-5p

• Accession: MIMAT0003410
• Description: Epstein Barr virus ebv-miR-BART3-5p mature miRNA
• Sequence: 12 - ACCUAGUGUUAGUGUUGUGCU - 32
• Evidence: experimental ; cloned [1,3], array [2], Northern [2]

Mature ebv-miR-BART3-3p

• Accession: MIMAT0003411
• Description: Epstein Barr virus ebv-miR-BART3-3p mature miRNA
• Sequence: 49 - CGCACCACUAGUCACCAGGUGU - 70
• Evidence: experimental ; cloned [1,3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16557291
   Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
   Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
   PLoS Pathog (2006) 2:e23


3. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750