miRBase entry: ebv-mir-BART4

Stem-loop ebv-mir-BART4


Accession
MI0003726
Description
Epstein Barr virus ebv-mir-BART4 precursor miRNA


Sequence

uuugguggGACCUGAUGCUGCUGGUGUGCUguaaauaagugccuagCACAUCACGUAGGCACCAGGUGUcaccagg
.(((((((.(((((.((((((((((((((((((......)))..))))))))).))).))).))))).))))))).

Structure
u       G     A   -   -         --   aa 
 uuggugg ACCUG UGC UGC UGGUGUGCU  gua  u
 ||||||| ||||| ||| ||| |||||||||  |||   
 gaccacU UGGAC ACG AUG ACUACACga  cgu  a
g       G     C   G   C         uc   ga 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
mir-BART4 was discovered independently by two groups. Cai et al. mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2].

Genome context
HHV507799: 139220-139295 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from ebv-mir-BART4
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART4 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART4-5p

Accession MIMAT0003412
Description Epstein Barr virus ebv-miR-BART4-5p mature miRNA
Sequence 9 - GACCUGAUGCUGCUGGUGUGCU - 30
Evidence experimental
cloned [1,3], array [2], Northern [2]

Mature ebv-miR-BART4-3p

Accession MIMAT0009204
Description Epstein Barr virus ebv-miR-BART4-3p mature miRNA
Sequence 47 - CACAUCACGUAGGCACCAGGUGU - 69
Evidence experimental
454 [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 19144710
    Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
    "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
    "J Virol (2009) 83:3333-3341

  3. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  4. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750