Stem-loop ebv-mir-BART5

Accession

MI0003727

Description

Epstein Barr virus ebv-mir-BART5 precursor miRNA

Sequence

gcucuguggcaccuCAAGGUGAAUAUAGCUGCCCAUCGacguaucgcuggaaaccgGUGGGCCGCUGUUCACCUaaagugacgcaaggu
(((.((((.(((....((((((..(((((.((((((((..((.((....)).)))))))))).)))))))))))...))).)))).)))

Structure

   c    g   cuCA      AU     U        ac  a  g 
gcu ugug cac    AGGUGA  AUAGC GCCCAUCG  gu uc c
||| |||| |||    ||||||  ||||| ||||||||  || ||  
ugg acgc gug    UCCACU  UGUCG CGGGUGgc  ca ag u
   a    a   -aaa      --     C        --  a  g 

Annotation confidence Not enough data

Comments

mir-BART5 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART6 in [2].

Genome context

HHV507799: 139661-139749 [+]

Clustered miRNAs

20 other miRNAs are < 10 kb from ebv-mir-BART5

Disease association

ebv-mir-BART5 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART5-5p

• Accession: MIMAT0003413
• Description: Epstein Barr virus ebv-miR-BART5-5p mature miRNA
• Sequence: 15 - CAAGGUGAAUAUAGCUGCCCAUCG - 38
• Evidence: experimental ; cloned [1,3], array [2], Northern [2]

Mature ebv-miR-BART5-3p

• Accession: MIMAT0009205
• Description: Epstein Barr virus ebv-miR-BART5-3p mature miRNA
• Sequence: 57 - GUGGGCCGCUGUUCACCU - 74
• Evidence: experimental ; 454 [4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 19144710
   Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas
   "Zhu JY, Pfuhl T, Motsch N, Barth S, Nicholls J, Grasser F, Meister G"
   "J Virol (2009) 83:3333-3341


3. PubMed ID: 16557291
   Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
   Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
   PLoS Pathog (2006) 2:e23


4. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750