Accession
MI0003728
Description
Epstein Barr virus
ebv-mir-BART6 precursor miRNA
Sequence
ugaccuuguugguacuuUAAGGUUGGUCCAAUCCAUAGGcuuuuuuugugaaaaccCGGGGAUCGGACUAGCCUUAGAguaacucaaggcca
...(((((....(((((((((((((((((.((((...((.(((((....))))).))..)))).)))))))))))))))))...)))))...
...(((((....(((((((((((((((((.((((...((.(((((....))))).))..)))).)))))))))))))))))...)))))...
Structure
uga uugg A AUA c u ccuug uacuuUAAGGUUGGUCC AUCC GG uuuuu u ||||| ||||||||||||||||| |||| || ||||| ggaac augAGAUUCCGAUCAGG UAGG Cc aaaag g acc -uca C -GG c u
Annotation confidence
Low
Do you think this miRNA is real?
Comments
mir-BART6 was discovered independently by two groups. Cai et al identified a mature miRNA product from the 3' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that the 5' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence was misnamed miR-BART9 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.
Genome context
HHV507799: 140016-140107 [+]
Clustered miRNAs
20 other miRNAs are < 10 kb from ebv-mir-BART6
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
ebv-mir-BART6 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature ebv-miR-BART6-5p
| Accession | MIMAT0003414 |
| Description | Epstein Barr virus ebv-miR-BART6-5p mature miRNA |
| Sequence | 18 - UAAGGUUGGUCCAAUCCAUAGG - 39 |
| Evidence |
experimental
array [2], Northern [2], cloned [3] |
Mature ebv-miR-BART6-3p
| Accession | MIMAT0003415 |
| Description | Epstein Barr virus ebv-miR-BART6-3p mature miRNA |
| Sequence | 57 - CGGGGAUCGGACUAGCCUUAGA - 78 |
| Evidence |
experimental
cloned [1,3] |
References
|
