miRBase entry: ebv-mir-BART12

Stem-loop ebv-mir-BART12


Accession
MI0003734
Description
Epstein Barr virus ebv-mir-BART12 precursor miRNA


Sequence


cuggugaccuaacacccgcccaucaccaccggacagauucugaacuugUCCUGUGGUGUUUGGUGUGGUUuugggguacgcag
(((((..(((((.(((((((...((((((.((((((.........)))))).))))))...)))).))).)))))..)).)))

Structure
   -  ga     c   -    cau      c      auu 
cug gu  ccuaa acc cgcc   caccac ggacag   c
||| ||  ||||| ||| ||||   |||||| ||||||   u
gac ca  ggguu UGG GUGG   GUGGUG CCUguu   g
   g  ug     U   U    UUU      U      caa 


Annotation confidence Low
Do you think this miRNA is real?
Comments
mir-BART12 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART16 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
HHV507799: 147888-147970 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART12
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART12 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART12

Accession MIMAT0003423
Description Epstein Barr virus ebv-miR-BART12 mature miRNA
Sequence 49 - UCCUGUGGUGUUUGGUGUGGUU - 70
Evidence experimental
cloned [1,3], array [2], Northern [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  3. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750