Accession
MI0003734
Description
Epstein Barr virus
ebv-mir-BART12 precursor miRNA
Sequence
cuggugaccuaacacccgcccaucaccaccggacagauucugaacuugUCCUGUGGUGUUUGGUGUGGUUuugggguacgcag
(((((..(((((.(((((((...((((((.((((((.........)))))).))))))...)))).))).)))))..)).)))
(((((..(((((.(((((((...((((((.((((((.........)))))).))))))...)))).))).)))))..)).)))
Structure
- ga c - cau c auu cug gu ccuaa acc cgcc caccac ggacag c ||| || ||||| ||| |||| |||||| |||||| u gac ca ggguu UGG GUGG GUGGUG CCUguu g g ug U U UUU U caa
Annotation confidence
Not enough data
Do you think this miRNA is real?
Comments
mir-BART12 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART16 in [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.
Genome context
HHV507799: 147888-147970 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART12
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
ebv-mir-BART12 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature ebv-miR-BART12
| Accession | MIMAT0003423 |
| Description | Epstein Barr virus ebv-miR-BART12 mature miRNA |
| Sequence | 49 - UCCUGUGGUGUUUGGUGUGGUU - 70 |
| Evidence |
experimental
cloned [1,3], array [2], Northern [2] |
References
|
