miRBase entry: ebv-mir-BART13

Stem-loop ebv-mir-BART13


Accession
MI0003735
Description
Epstein Barr virus ebv-mir-BART13 precursor miRNA


Sequence

uugggcaccucgauAACCGGCUCGUGGCUCGUACAGacgauuguuuggcucUGUAACUUGCCAGGGACGGCUGAcgauguguuuag
.(((((((.(((.((.(((.(((.((((...(((((((.(.....).).))))))....))))))).))).)).))).))))))).

Structure
u       c   a  A   G   G    -UCG      - g u 
 ugggcac ucg uA CCG CUC UGGC    UACAGa c a u
 ||||||| ||| || ||| ||| ||||    |||||| | | g
 auuugug agc GU GGC GGG ACCG    AUGUcu g u u
g       u   A  C   A   -    UUCA      c g u 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
mir-BART13 was discovered independently by two groups. Cai et al mapped the ends of the mature sequence by cloning [1]. Grundhoff et al confirmed that the 3' arm gives rise to a mature miRNA product, but didnot experimentally determine the extents of that product [2]. This sequence is misnamed miR-BART19 in [2].

Genome context
HHV507799: 148512-148597 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART13
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART13 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART13-5p

Accession MIMAT0004818
Description Epstein Barr virus ebv-miR-BART13-5p mature miRNA
Sequence 15 - AACCGGCUCGUGGCUCGUACAG - 36
Evidence experimental
cloned [3]

Mature ebv-miR-BART13-3p

Accession MIMAT0003424
Description Epstein Barr virus ebv-miR-BART13-3p mature miRNA
Sequence 52 - UGUAACUUGCCAGGGACGGCUGA - 74
Evidence experimental
cloned [1,3], array [2], Northern [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16557291
    Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
    Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
    PLoS Pathog (2006) 2:e23

  3. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750