Stem-loop ebv-mir-BART14

Accession

MI0003736

Description

Epstein Barr virus ebv-mir-BART14 precursor miRNA

Sequence

cagggguggccggUACCCUACGCUGCCGAUUUACAuaauauaaauugUAAAUGCUGCAGUAGUAGGGAUcuggacgcgcgaccug
((((.((((((((..(((((((((((.((((((((..........))))))).).))))).))))))..)))).).)))..))))

Structure

    -g   - -    UA      -     C -       uaau 
cagg  gug g ccgg  CCCUAC GCUGC G AUUUACA    a
||||  ||| | ||||  |||||| ||||| | |||||||     
gucc  cgc c gguc  GGGAUG UGACG C UAAAUgu    u
    ag   g a    UA      A     U G       uaaa 

Annotation confidence Not enough data

Comments

mir-BART14 was discovered independently by two groups. Cai et al identified a mature miRNA products from the 5' arm of the hairpin precursor and mapped the ends of the mature sequence by cloning [1]. Grundhoff et al report that both arms give rise to a mature miRNA products, but didnot experimentally determine the extents of those products [2]. The ends of ebv-miR-BART14-3p are therefore predicted, not experimentally determined. This sequence is nisnamed miR-BART20 in [2]. The mature miRNA names reflect cloning frequencies from Landgraf et al. [3], and may differ subtly from previous annotations.

Genome context

HHV507799: 148731-148815 [+]

Clustered miRNAs

21 other miRNAs are < 10 kb from ebv-mir-BART14

Disease association

ebv-mir-BART14 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART14-5p

• Accession: MIMAT0003425
• Description: Epstein Barr virus ebv-miR-BART14-5p mature miRNA
• Sequence: 14 - UACCCUACGCUGCCGAUUUACA - 35
• Evidence: experimental ; cloned [1,3], array [2], Northern [2]

Mature ebv-miR-BART14-3p

• Accession: MIMAT0003426
• Description: Epstein Barr virus ebv-miR-BART14-3p mature miRNA
• Sequence: 48 - UAAAUGCUGCAGUAGUAGGGAU - 69
• Evidence: experimental ; array [2], Northern [2], cloned [3]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16557291
   Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed
   Cai X, Schäfer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR
   PLoS Pathog (2006) 2:e23


3. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750