miRBase entry: hsa-mir-758

Stem-loop hsa-mir-758


Accession
MI0003757
Symbol
HGNC: MIR758
Description
Homo sapiens hsa-mir-758 precursor miRNA mir-379
Gene
family?
RF04292; mir-379

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR758 is a microRNA (miRNA) that has been studied in the context of its expression in relation to certain treatments and its location within the genome. Treatment with a specific agent for 24 hours was found to reduce the expression of several miRNAs, including MIR758, as shown by qRT-PCR results [PMC6100038]. MIR758, along with other miRNAs, has been identified as having a role in inhibiting the expression or function of the ATP-binding cassette transporter A1 (ABCA1) [PMC6100038]. However, there is no evidence provided that MIR758 expression is associated with cellular processes such as proliferation and differentiation, nor that it has been implicated in neuroblastoma progression [PMC9866967]. In canine genomes, MIR758 is notably located within a cluster of differentially expressed (DE) miRNAs on chromosome 8 [PMC8376273]. This cluster includes several other miRNAs that have been profiled for their expression levels [PMC10148110].

Literature search
38 open access papers mention hsa-mir-758
(123 sentences)

Sequence

3038 reads, 9.0 reads per million, 99 experiments
gccuggauacaugagAUGGUUGACCAGAGAGCACACGcuuuauuugugccgUUUGUGACCUGGUCCACUAACCcucaguaucuaaugc
...(((((((.((((.((((.((((((.(.(((.((((.........).))).)))..))))))).))))...)))))))))))....

Structure
-gcc       a    --A    U      A -A   C   - uuu 
    uggauac ugag   UGGU GACCAG G  GCA ACG c   a
    ||||||| ||||   |||| |||||| |  ||| ||| |   u
    aucuaug acuc   AUCA CUGGUC C  UGU Ugc g   u
cgua       -    CCA    C      - AG   U   c ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101026020-101026107 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from hsa-mir-758
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-758 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-758-5p

Accession MIMAT0022929
Description Homo sapiens hsa-miR-758-5p mature miRNA
Sequence 16 - AUGGUUGACCAGAGAGCACACG - 37
Evidence experimental
SOLiD [3]
Database links
Predicted targets

Mature hsa-miR-758-3p

Accession MIMAT0003879
Description Homo sapiens hsa-miR-758-3p mature miRNA
Sequence 52 - UUUGUGACCUGGUCCACUAACC - 73
Evidence experimental
cloned [1-2], SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484