miRBase entry: hsa-mir-758

Stem-loop hsa-mir-758


Accession
MI0003757
Symbol
HGNC: MIR758
Description
Homo sapiens hsa-mir-758 precursor miRNA mir-379
Gene
family?
RF04292; mir-379

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR758 is a specific candidate microRNA that has been shown to inhibit the expression or function of ABCA1 [PMC6100038]. Treatment with 1m for 24 h was found to reduce the expression of MIR758, along with other microRNAs such as miR155, miR10b, miR145, miR33, and miR106b [PMC6100038]. Additionally, MIR758 was detected as one of the significantly changed microRNAs in various conditions and diseases such as endometrial, prostate, and breast carcinoma [PMC9866967]. It has also been associated with cell proliferation and differentiation control and neuroblastoma progression [PMC9866967]. Furthermore, in a genomic analysis using the dog reference genome CanFam3.1, MIR758 was found to be one of the strongly differentially expressed microRNAs in a specific region [PMC8376273]. The cluster containing MIR758 also included other microRNAs such as miR134, miR154, miR369, and miR655 [PMC10148110]. Overall, MIR758 is a candidate microRNA that has been implicated in various biological processes and diseases. It is involved in regulating ABCA1 expression or function and has been associated with cell proliferation control and neuroblastoma progression. Additionally, its differential expression has been observed in different conditions using genomic analysis.

Literature search
14 open access papers mention hsa-mir-758
(44 sentences)

Sequence

729 reads, 57 reads per million, 48 experiments
gccuggauacaugaGAUGGUUGACCAGAGAGCACACgcuuuauuugugccgUUUGUGACCUGGUCCACUAACCcucaguaucuaaugc
...(((((((.((((.((((.((((((.(.(((.((((.........).))).)))..))))))).))))...)))))))))))....

Structure
-gcc       a    --A    U      A -A   C   - uuu 
    uggauac ugaG   UGGU GACCAG G  GCA ACg c   a
    ||||||| ||||   |||| |||||| |  ||| ||| |   u
    aucuaug acuc   AUCA CUGGUC C  UGU Ugc g   u
cgua       -    CCA    C      - AG   U   c ugu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101026020-101026107 [+]
Clustered miRNAs
12 other miRNAs are < 10 kb from hsa-mir-758
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-758 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-758-3p

Accession MIMAT0003879
Description Homo sapiens hsa-miR-758-3p mature miRNA
Sequence 52 - UUUGUGACCUGGUCCACUAACC - 73
Evidence experimental
cloned [1-2], SOLiD [3]
Database links
Predicted targets

Mature hsa-miR-758-5p

Accession MIMAT0022929
Description Homo sapiens hsa-miR-758-5p mature miRNA
Sequence 15 - GAUGGUUGACCAGAGAGCACAC - 36
Evidence experimental
SOLiD [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 22282338
    Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs
    "Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F"
    "RNA (2012) 18:472-484