miRBase entry: hsa-mir-671

Stem-loop hsa-mir-671


Accession
MI0003760
Symbol
HGNC: MIR671
Description
Homo sapiens hsa-mir-671 precursor miRNA mir-671
Gene
family?
RF00891; mir-671

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR671 is a microRNA implicated in various biological processes and diseases, including immune response and retinal degeneration [PMC8362665]. It is contained within EpCAM-Exos and is associated with several novel miRNAs [PMC5137021]. Studies have shown that MIR671, along with other genes, is upregulated in response to increased macrophage/microglia activity as retinal degeneration progresses [PMC8362665], [PMC4872275]. It also appears to regulate extracellular matrix production and can act as a sponge for target transcripts, although it can be cleaved by other miRNAs [PMC4872275], [PMC9918958]. In the context of preeclampsia, MIR671 is among the miRNAs that are significantly increased, contributing to various pathological conditions such as renal fibrosis and inflammatory processes [PMC5933288]. Additionally, MIR671 has been identified within upregulated genes in non-protein coding regions associated with intragenic miRNAs that are implicated in downregulation or upregulation of certain cellular processes [PMC5823624].

Literature search
40 open access papers mention hsa-mir-671
(291 sentences)

Sequence

23349 reads, 101 reads per million, 141 experiments
gcaggugaacuggcaggccaggaagaggAGGAAGCCCUGGAGGGGCUGGAGgugauggauguuuuccUCCGGUUCUCAGGGCUCCACCucuuucgggccguagagccagggcuggugc
(((...(..(((((.((((.((((((((.(((.((((((..(((((((((((.((.......)).)))))))))))))))))))).)))))))).)))).....)))))..)...)))

Structure
   ggu aa     ----a    a        A   A      GA           u  ug 
gca   g  cuggc     ggcc ggaagagg GGA GCCCUG  GGGGCUGGAGg ga  g
|||   |  |||||     |||| |||||||| ||| ||||||  ||||||||||| ||  a
cgu   c  gaccg     ccgg cuuucuCC CCU CGGGAC  UCUUGGCCUcc uu  u
   ggu gg     agaug    g        A   -      --           u  ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
chr7: 151238421-151238538 [+]

Disease association
hsa-mir-671 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-671-5p

Accession MIMAT0003880
Description Homo sapiens hsa-miR-671-5p mature miRNA
Sequence 29 - AGGAAGCCCUGGAGGGGCUGGAG - 51
Evidence experimental
cloned [1-2]
Database links
Predicted targets

Mature hsa-miR-671-3p

Accession MIMAT0004819
Description Homo sapiens hsa-miR-671-3p mature miRNA
Sequence 68 - UCCGGUUCUCAGGGCUCCACC - 88
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298