MIR767 is a microRNA that has been studied in various contexts. In one study, the level of MIR767 was explored in senescent vascular endothelial cells-derived exosomes and its expression levels were examined after co-culture with skin fibroblasts [PMC9908644]. Additionally, a 214.11-kb duplication in the chromosomal Xq28 region, which includes the GABRA3, MIR105-1, MIR767, and MIR105-2 genes, was identified in a proband via microarray analysis and was inherited from his healthy mother [PMC6894506]. This duplication has been associated with mental development abnormalities [PMC6894506]. In another study comparing miRNA expression levels in PANC-1 cells and hTERT-HPNE cells, it was found that MIR767 showed higher expression levels in PANC-1 cells compared to hTERT-HPNE cells [PMC3849454]. The function of MIR767 is largely unknown at this time [PMC3849454]. Additionally, another miRNA called MIR1269 showed similar expression patterns to MIR767 in the same study. However, its function is also largely unknown except for a potential role during differentiation of human embryonic stem cells [PMC3849454].
-uuuu u u UGC UU C U c gc aua ug agguuuuugcuca ACCAUGG GU UGAGCA Gcag a || ||| || ||||||||||||| ||||||| || |||||| |||| u cg ugu ac uccaaggacgagU UGGUACC CA ACUCGU Uguu g ucauc u u CUU -C U C c
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003882 |
Description | Homo sapiens hsa-miR-767-5p mature miRNA |
Sequence | 27 - UGCACCAUGGUUGUCUGAGCAUG - 49 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0003883 |
Description | Homo sapiens hsa-miR-767-3p mature miRNA |
Sequence | 61 - UCUGCUCAUACCCCAUGGUUUCU - 83 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|