Stem-loop hsa-mir-449c

Accession

MI0003823

Symbol

HGNC: MIR449C

Description

Homo sapiens hsa-mir-449c precursor miRNA mir-449

Gene
family

RF00711; mir-449

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR449C is a microRNA that is upregulated in response to air exposure in an AhR-dependent manner and is part of a hyper-conserved region that includes the miR34a/b/c and let-7a miRNA seed sequence regions [PMC4999520][PMC6576772[PMC6576772]. This microRNA is highly homologous to miR449a and miR449b, suggesting a conserved function across these variants [PMC6412851]. It plays a crucial role in various biological processes, including brain development, motile ciliogenesis, spermatogenesis, and acts as a tumor suppressor in liver cancer by promoting cell death and inhibiting cell migration [PMC7528684]. MIR449C's overexpression leads to the expansion of monocytic myeloid-derived suppressor cells (mo-MDSCs), while its knockdown inhibits the differentiation of myeloid progenitor cells into mo-MDSCs [PMC7528684]. Additionally, STAT6 has been identified as a novel downstream target of MIR449C during myeloid progenitor cell differentiation [PMC7528684]. MIR449C has been recognized as an important regulator of proliferation and invasion in various cancers including nonsmall cell lung cancer and gastric cancer [PMC7528684], with its expression alterations observed across different isomiR families in cancer studies [PMC8705090]. It is also encoded within the Emca3 region along with other small RNAs such as miR449a and miR582 [PMC4132170].

Literature search

69 open access papers mention hsa-mir-449c
(386 sentences)

Sequence

930 reads, 35 reads per million, 42 experiments

gcugggaugugucaggUAGGCAGUGUAUUGCUAGCGGCUGUuaaugauuuuaacagUUGCUAGUUGCACUCCUCUCUGUugcauucagaagc
(((.((((((..((((.(((.((((((..(((((((((((((((.....)))))))))))))))))))))))).))))..))))))...)))

Structure

   --g      gu    U   C      UU               u 
gcu   ggaugu  cagg AGG AGUGUA  GCUAGCGGCUGUuaa g
|||   ||||||  |||| ||| ||||||  ||||||||||||||| a
cga   cuuacg  GUCU UCC UCACGU  UGAUCGUUgacaauu u
   aga      uU    C   -      --               u 

Annotation confidence High

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using the RAKE techniques [1]. Expression was later confirmed by Wyman et al. [2].

Genome context

chr5: 55172262-55172353 [-]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-449c

Disease association

hsa-mir-449c is associated with one or more human diseases in the Human microRNA Disease Database

Biological pathways

hsa-mir-449c is involved in one or more biological pathways:

(Source: Reactome)

Biological reactions

hsa-mir-449c is involved in one or more regulation/signalling events:

(Source: Reactome)

Mature hsa-miR-449c-5p

• Accession: MIMAT0010251
• Description: Homo sapiens hsa-miR-449c-5p mature miRNA
• Sequence: 17 - UAGGCAGUGUAUUGCUAGCGGCUGU - 41
• Evidence: experimental ; RAKE [1], 454 [2]

Mature hsa-miR-449c-3p

• Accession: MIMAT0013771
• Description: Homo sapiens hsa-miR-449c-3p mature miRNA
• Sequence: 57 - UUGCUAGUUGCACUCCUCUCUGU - 79
• Evidence: experimental ; 454 [2]

References

1. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


2. PubMed ID: 19390579
   Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries
   Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M
   PLoS One (2009) 4:e5311