WARNING: This summary was generated by AI. MIR449C is a microRNA that is upregulated in response to air exposure in an AhR-dependent manner and is part of a hyper-conserved region that includes the miR34a/b/c and let-7a miRNA seed sequence regions [PMC4999520][PMC6576772[PMC6576772]. This microRNA is highly homologous to miR449a and miR449b, suggesting a conserved function across these variants [PMC6412851]. It plays a crucial role in various biological processes, including brain development, motile ciliogenesis, spermatogenesis, and acts as a tumor suppressor in liver cancer by promoting cell death and inhibiting cell migration [PMC7528684]. MIR449C's overexpression leads to the expansion of monocytic myeloid-derived suppressor cells (mo-MDSCs), while its knockdown inhibits the differentiation of myeloid progenitor cells into mo-MDSCs [PMC7528684]. Additionally, STAT6 has been identified as a novel downstream target of MIR449C during myeloid progenitor cell differentiation [PMC7528684]. MIR449C has been recognized as an important regulator of proliferation and invasion in various cancers including nonsmall cell lung cancer and gastric cancer [PMC7528684], with its expression alterations observed across different isomiR families in cancer studies [PMC8705090]. It is also encoded within the Emca3 region along with other small RNAs such as miR449a and miR582 [PMC4132170].
--g gu U C UU u gcu ggaugu cagg AGG AGUGUA GCUAGCGGCUGUuaa g ||| |||||| |||| ||| |||||| ||||||||||||||| a cga cuuacg GUCU UCC UCACGU UGAUCGUUgacaauu u aga uU C - -- u
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0010251 |
| Description | Homo sapiens hsa-miR-449c-5p mature miRNA |
| Sequence | 17 - UAGGCAGUGUAUUGCUAGCGGCUGU - 41 |
| Evidence |
experimental
RAKE [1], 454 [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0013771 |
| Description | Homo sapiens hsa-miR-449c-3p mature miRNA |
| Sequence | 57 - UUGCUAGUUGCACUCCUCUCUGU - 79 |
| Evidence |
experimental
454 [2] |
|