miRBase entry: hsa-mir-449c

Stem-loop hsa-mir-449c


Accession
MI0003823
Symbol
HGNC: MIR449C
Description
Homo sapiens hsa-mir-449c precursor miRNA mir-449
Gene
family?
RF00711; mir-449

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR449C is a microRNA that is upregulated in response to air exposure in an AhR-dependent manner and is part of a hyper-conserved region that includes the miR34a/b/c and let-7a miRNA seed sequence regions [PMC4999520][PMC6576772[PMC6576772]. This microRNA is highly homologous to miR449a and miR449b, suggesting a conserved function across these variants [PMC6412851]. It plays a crucial role in various biological processes, including brain development, motile ciliogenesis, spermatogenesis, and acts as a tumor suppressor in liver cancer by promoting cell death and inhibiting cell migration [PMC7528684]. MIR449C's overexpression leads to the expansion of monocytic myeloid-derived suppressor cells (mo-MDSCs), while its knockdown inhibits the differentiation of myeloid progenitor cells into mo-MDSCs [PMC7528684]. Additionally, STAT6 has been identified as a novel downstream target of MIR449C during myeloid progenitor cell differentiation [PMC7528684]. MIR449C has been recognized as an important regulator of proliferation and invasion in various cancers including nonsmall cell lung cancer and gastric cancer [PMC7528684], with its expression alterations observed across different isomiR families in cancer studies [PMC8705090]. It is also encoded within the Emca3 region along with other small RNAs such as miR449a and miR582 [PMC4132170].

Literature search
92 open access papers mention hsa-mir-449c
(521 sentences)

Sequence

5471 reads, 24.0 reads per million, 86 experiments
gcugggaugugucagguAGGCAGUGUAUUGCUAGCGGCUGUUaaugauuuuaaCAGUUGCUAGUUGCACUCCUCUcuguugcauucagaagc
(((.((((((..((((.(((.((((((..(((((((((((((((.....)))))))))))))))))))))))).))))..))))))...)))

Structure
   --g      gu    u   C      UU               u 
gcu   ggaugu  cagg AGG AGUGUA  GCUAGCGGCUGUUaa g
|||   ||||||  |||| ||| ||||||  ||||||||||||||| a
cga   cuuacg  gucU UCC UCACGU  UGAUCGUUGACaauu u
   aga      uu    C   -      --               u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using the RAKE techniques [1]. Expression was later confirmed by Wyman et al. [2].

Genome context
chr5: 55172262-55172353 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-449c
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-449c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-449c is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-449c is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-449c-5p

Accession MIMAT0010251
Description Homo sapiens hsa-miR-449c-5p mature miRNA
Sequence 18 - AGGCAGUGUAUUGCUAGCGGCUGUU - 42
Evidence experimental
RAKE [1], 454 [2]
Database links
Predicted targets

Mature hsa-miR-449c-3p

Accession MIMAT0013771
Description Homo sapiens hsa-miR-449c-3p mature miRNA
Sequence 54 - CAGUUGCUAGUUGCACUCCUCU - 75
Evidence experimental
454 [2]

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 19390579
    Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries
    Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M
    PLoS One (2009) 4:e5311