miRBase entry: ppt-MIR1211

Stem-loop ppt-MIR1211


Accession
MI0004710
Description
Physcomitrella patens ppt-MIR1211 precursor miRNA


Sequence


uuacaugauugucaacAGGGAGGGAUGGUUAUGCAAGagggugcaagagguggcagaucaucucuugaagcaucuUGCAUGACCGUCUCUUCCUGCagguagaguuauguaa
.(((((((((.((..(((((((((((((((((((((((.(.(.(((((((((......))))))))).).).)))))))))))))))))))))))...).).))))))))).

Structure
u         g - -aa                       g g g         gc 
 uacaugauu u c   cAGGGAGGGAUGGUUAUGCAAGa g u caagaggug  a
 ||||||||| | |   ||||||||||||||||||||||| | | |||||||||   
 auguauuga a g   GUCCUUCUCUGCCAGUACGUucu c a guucucuac  g
a         g u gaC                       a g a         ua 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Talmor-Neiman et al. identified a mature miRNA from the 5' arm of this precursor, and called it miR1211 [1]. Axtell et al. show by deep sequencing that the 3' product is the predominant one [3]. The 5' miRNA is renamed miR1211* here.

Genome context
Chr04: 8310044-8310155 [-]

Database links

Mature ppt-miR1211-5p

Accession MIMAT0003900
Description Physcomitrella patens ppt-miR1211-5p mature miRNA
Sequence 17 - AGGGAGGGAUGGUUAUGCAAG - 37
Evidence experimental
Northern [1]

Mature ppt-miR1211-3p

Accession MIMAT0004829
Description Physcomitrella patens ppt-miR1211-3p mature miRNA
Sequence 76 - UGCAUGACCGUCUCUUCCUGC - 96
Evidence experimental
454 [2]

References

  1. PubMed ID: 17601824
    Common functions for diverse small RNAs of land plants
    "Axtell MJ, Snyder JA, Bartel DP"
    "Plant Cell (2007) 19:1750-1769

  2. PubMed ID: 16824179
    Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss
    "Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T"
    "Plant J (2006) 47:25-37