miRBase entry: ppt-MIR1219a

Stem-loop ppt-MIR1219a


Accession
MI0004718
Description
Physcomitrella patens ppt-MIR1219a precursor miRNA


Sequence


ugaaguguggacgauggagagucagccuCUUCCUGCCUCUCACUAGCUUcaucccuuccucccuaaauuuuagucugggagggaaggagcuauugguggucaggaauagcgcacccuucauuuauccacacuuca
(((((((((((.(((((((.((..((((.((((((((.(.((.(((((((.((((((((...((((...))))...)))))))).))))))).))).)).)))))).)).)))).)))))))..)))))))))))

Structure
           -c       a  ca  -  C      -  U U  C       a        ucc    a 
ugaagugugga  gauggag gu  gc cu UUCCUG CC C CA UAGCUUc ucccuucc   cuaa  
|||||||||||  ||||||| ||  || || |||||| || | || ||||||| ||||||||   |||| u
acuucacaccu  uuacuuc ca  cg ga aaggac gg g gu aucgagg agggaggg   gauu  
           au       c  --  c  u      u  u -  u       a        ucu    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr04: 10210326-10210460 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from ppt-MIR1219a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ppt-miR1219a

Accession MIMAT0003908
Description Physcomitrella patens ppt-miR1219a mature miRNA
Sequence 29 - CUUCCUGCCUCUCACUAGCUU - 49
Evidence experimental
Northern [1], 454 [2]

References

  1. PubMed ID: 17601824
    Common functions for diverse small RNAs of land plants
    "Axtell MJ, Snyder JA, Bartel DP"
    "Plant Cell (2007) 19:1750-1769

  2. PubMed ID: 16824179
    Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss
    "Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T"
    "Plant J (2006) 47:25-37