Stem-loop ebv-mir-BART15

Accession

MI0004988

Description

Epstein Barr virus ebv-mir-BART15 precursor miRNA

Sequence

ugugccgcuuggagggaaacaugaccaccugaagucuguuaaccagGUCAGUGGUUUUGUUUCCUUGAuagagacaca
((((.(.((...(((((((((.((((((.(((..((((.....))))))))))))).)))))))))...)).).))))

Structure

    c g  ugg         u      c   ag    u 
ugug c cu   agggaaaca gaccac uga  ucug u
|||| | ||   ||||||||| |||||| |||  |||| a
acac g ga   UUCCUUUGU UUGGUG ACU  Ggac a
    a a  uAG         U      -   --    c 

Annotation confidence Not enough data

Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART5 by Grundhoff et al [1] but is not related to ebv-miR-BART5 (MIR:MI0003727). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

HHV507799: 139507-139584 [+]

Clustered miRNAs

20 other miRNAs are < 10 kb from ebv-mir-BART15

Disease association

ebv-mir-BART15 is associated with one or more human diseases in the Human microRNA Disease Database

Mature ebv-miR-BART15

• Accession: MIMAT0003713
• Description: Epstein Barr virus ebv-miR-BART15 mature miRNA
• Sequence: 47 - GUCAGUGGUUUUGUUUCCUUGA - 68
• Evidence: experimental ; array [1], Northern [1], cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16540699
   A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
   "Grundhoff A, Sullivan CS, Ganem D"
   "RNA (2006) 12:733-750