miRBase entry: ebv-mir-BART19

Stem-loop ebv-mir-BART19


Accession
MI0004992
Description
Epstein Barr virus ebv-mir-BART19 precursor miRNA


Sequence


guauccguguccugacaACAUUCCCCGCAAACAUGACAUGgguuaauuuaaacaugUUUUGUUUGCUUGGGAAUGCUcuuagggccuggaagc
((.((((.(((((((...(((((((.(((((((.((((((..(......)..)))))).)))))))..)))))))...))))))).)))).))

Structure
  a    u       caA       -C       U      gg ua 
gu uccg guccuga   CAUUCCC  GCAAACA GACAUG  u  a
|| |||| |||||||   |||||||  ||||||| ||||||  |   
cg aggu cgggauu   GUAAGGG  CGUUUGU UUguac  a  u
  a    c       cUC       UU       U      aa uu 


Annotation confidence Low
Do you think this miRNA is real?
Comments
The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART17 by Grundhoff et al [1]. The mature miRNA names and sequences reflect cloning frequencies from Landgraf et al. [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
HHV507799: 148198-148290 [+]
Clustered miRNAs
21 other miRNAs are < 10 kb from ebv-mir-BART19
Name Accession Chromosome Start End Strand Confidence




Disease association
ebv-mir-BART19 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature ebv-miR-BART19-5p

Accession MIMAT0004836
Description Epstein Barr virus ebv-miR-BART19-5p mature miRNA
Sequence 18 - ACAUUCCCCGCAAACAUGACAUG - 40
Evidence experimental
cloned [2]

Mature ebv-miR-BART19-3p

Accession MIMAT0003718
Description Epstein Barr virus ebv-miR-BART19-3p mature miRNA
Sequence 57 - UUUUGUUUGCUUGGGAAUGCU - 77
Evidence experimental
array [1], Northern [1], cloned [2]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16540699
    A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
    "Grundhoff A, Sullivan CS, Ganem D"
    "RNA (2006) 12:733-750