MIR765 is a microRNA that has been identified as consistently down-regulated across all central nervous system (CNS) tumor samples, suggesting its potential as a diagnostic marker for these tumors [PMC8235499]. This miRNA, along with others, has been found to significantly alter the expression of genes involved in cancer pathways, indicating its role in the molecular mechanisms of cancer [PMC8229109]. The inhibition of miR-765 through the transfection of a MIR765 inhibitor has been shown to suppress proliferation, migration, and invasion in non-small cell lung cancer (NSCLC) cells [PMC8349552]. Moreover, MIR765 is located within a region that is amplified in malignant melanoma (MM), suggesting its possible involvement in melanomagenesis [PMC4619539]. It is also consistent across different procedures and has been implicated in various cancers including liver, prostate, and bone cancers [PMC5025515; PMC8191793].. Additionally, MIR765 interacts with circular RNAs that can regulate the expression of target genes such as GALNT2 within peripheral blood mononuclear cells (PBMCs) of patients with IgA nephropathy (IgAN), further highlighting its regulatory capacity [PMC7719294].
u g - u aguggag guag agc ------ cga uuaggc c uga gaa uuca ac ccuuuuc aagcccua g |||||| | ||| ||| |||| || ||||||| |||||||| aguccg g gcu cuu aaGU UG GGAAGAG uuuggggu a a a u - gucuagg --AG GAA GAGGUc caa
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0003945 |
| Description | Homo sapiens hsa-miR-765 mature miRNA |
| Sequence | 69 - UGGAGGAGAAGGAAGGUGAUG - 89 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|