miRBase entry: hsa-mir-765

Stem-loop hsa-mir-765


Accession
MI0005116
Symbol
HGNC: MIR765
Description
Homo sapiens hsa-mir-765 precursor miRNA mir-765
Gene
family?
RF01027; mir-765

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR765 is a miRNA gene that has been found to be down-regulated in CNS tumor samples [PMC8235499]. It is one of five miRNAs, along with MIR149, MIR214, MIR574, and MIR595, that were consistently down-regulated across all CNS tumor samples [PMC8235499]. These miRNAs have been identified as potential diagnostic markers for CNS tumors [PMC8235499]. In addition to its role in CNS tumors, MIR765 has also been implicated in other types of cancer such as liver, prostate, and bone cancers [PMC8191793]. The downregulation of MIR765 has been shown to inhibit the proliferation, migration, and invasion of non-small cell lung cancer cells [PMC8349552]. Furthermore, MIR765 has been identified as a potential ceRNA (competitive endogenous RNA) for GALNT2 in IgA nephropathy (IgAN) [PMC7719294]. GALNT2 was found to be significantly down-regulated in the peripheral blood mononuclear cells (PBMCs) of IgAN patients and the identified circRNAs were shown to potentially manipulate the expression of GALNT2 through their interaction with MIR765 [PMC7719294]. Overall, these findings highlight the importance of MIR765 in various types of cancer and its potential as a diagnostic marker and therapeutic target.

Literature search
17 open access papers mention hsa-mir-765
(58 sentences)

Sequence

300 reads, 53 reads per million, 59 experiments
uuuaggcgcugaugaaaguggaguucaguagacagcccuuuucaagcccuacgagaaacugggguuucUGGAGGAGAAGGAAGGUGAUGaaggaucuguucucgugagccugaa
.((((((.((((.(((.......((((....((...(((((((((((((((........))))))))......)))))))...))..)))).......)))))).).)))))).

Structure
u      g -   u   aguggag    guag  agc       ------        cga 
 uuaggc c uga gaa       uuca    ac   ccuuuuc      aagcccua   g
 |||||| | ||| |||       ||||    ||   |||||||      ||||||||    
 aguccg g gcu cuu       aaGU    UG   GGAAGAG      uuuggggu   a
a      a u   -   gucuagg    --AG  GAA       GAGGUc        caa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 156936131-156936244 [-]

Disease association
hsa-mir-765 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-765

Accession MIMAT0003945
Description Homo sapiens hsa-miR-765 mature miRNA
Sequence 69 - UGGAGGAGAAGGAAGGUGAUG - 89
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298