MIR765 is a miRNA gene that has been found to be down-regulated in CNS tumor samples [PMC8235499]. It is one of five miRNAs, along with MIR149, MIR214, MIR574, and MIR595, that were consistently down-regulated across all CNS tumor samples [PMC8235499]. These miRNAs have been identified as potential diagnostic markers for CNS tumors [PMC8235499]. In addition to its role in CNS tumors, MIR765 has also been implicated in other types of cancer such as liver, prostate, and bone cancers [PMC8191793]. The downregulation of MIR765 has been shown to inhibit the proliferation, migration, and invasion of non-small cell lung cancer cells [PMC8349552]. Furthermore, MIR765 has been identified as a potential ceRNA (competitive endogenous RNA) for GALNT2 in IgA nephropathy (IgAN) [PMC7719294]. GALNT2 was found to be significantly down-regulated in the peripheral blood mononuclear cells (PBMCs) of IgAN patients and the identified circRNAs were shown to potentially manipulate the expression of GALNT2 through their interaction with MIR765 [PMC7719294]. Overall, these findings highlight the importance of MIR765 in various types of cancer and its potential as a diagnostic marker and therapeutic target.
u g - u aguggag guag agc ------ cga uuaggc c uga gaa uuca ac ccuuuuc aagcccua g |||||| | ||| ||| |||| || ||||||| |||||||| aguccg g gcu cuu aaGU UG GGAAGAG uuuggggu a a a u - gucuagg --AG GAA GAGGUc caa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0003945 |
Description | Homo sapiens hsa-miR-765 mature miRNA |
Sequence | 69 - UGGAGGAGAAGGAAGGUGAUG - 89 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
|