Accession
MI0005454
Description
Bos taurus
bta-let-7c precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Bta-let-7c is a microRNA that has been observed in both placental exosomes and non-pregnant exosomes, with significant differences in expression compared to other bta-let-7 microRNAs [PMC5999645]. Overexpression of bta-let-7c has been shown to decrease the expression of NRAS and downregulate LPS-induced proinflammatory cytokines [PMC5999645]. Bta-let-7c, along with bta-let-7a-5p and bta-miR-196b, may regulate glycerophospholipid metabolism by inhibiting the expression of enzymes involved in triglyceride synthesis and degradation [PMC5341059]. Bta-miR-148a, bta-miR30a-5p, bta-miR30d, and bta-miR30d were found to be among the top 10 expressed miRNAs in different species of milk [PMC7191744]. Bta-miR127 and bta-let7c have been implicated in the regulation of inflammatory response [PMC4617749]. Bta-miR127 is known to regulate a specific gene along with btalet7c [PMC7937231]. Btale t 7c was found to be differentially expressed in CoPS vs. H comparison [PMC7937231]. In different tissues such as ovary and testis, several miRNAs including btamir143, btamir378, btale t 7f were found to be dominant expressed miRNAs with more than 100000 reads [PMC3164151]. In Holstein cattle several miRNAs including btamir143 were found to be most abundant [PMC5410099]. The role of target interleukin1 (IL1) may be affected by btamir181d and btale t 7c in regulating the mammary gland function of dairy cows [PMC9686552].
Literature search
52 open access papers mention bta-let-7c
(234 sentences)
(234 sentences)
Sequence
243137
reads,
1399
reads per million, 76 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaacuguacaaccuucuagcuuuccuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))
Structure
a uU G U ua g ua c gc uccggg GAG UAG AGGUUGUAUGGUU ga u ca || |||||| ||| ||| ||||||||||||| || | || c cg agguuc uuc auc uccaacaugucaa uu a gu - cu g u -- g gg c
Annotation confidence
High
Do you think this miRNA is real?
Genome context
chr1: 19984844-19984927 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-let-7c
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Database links
Mature bta-let-7c
| Accession | MIMAT0004332 |
| Description | Bos taurus bta-let-7c mature miRNA |
| Sequence | 11 - UGAGGUAGUAGGUUGUAUGGUU - 32 |
| Evidence |
experimental
cloned [1] |
References
|
