Stem-loop bta-mir-15a

Accession

MI0005458

Description

Bos taurus bta-mir-15a precursor miRNA mir-15

Gene
family

RF00455; mir-15

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

Bovine microRNA bta-mir-15a, a highly abundant miRNA in X sperm, has been implicated in various biological processes in dairy cows [PMC7505075]. It is significantly upregulated in mastitis-related conditions [PMC6107498] and has been suggested as a novel regulator promoting lactation in mammary epithelial cells [PMC6268530]. Despite its presence, bta-mir-15a expression levels do not significantly differ between B cells of BLV-infected and uninfected cattle [PMC8432782]. It is down-regulated upon data normalization, indicating its expression is sensitive to analytical methods [PMC3589390]. Bta-mir-15a has been shown to inhibit the expression of the growth hormone receptor (GHR) protein at the translational level, indirectly affecting casein synthesis, although the underlying mechanisms remain to be elucidated [PMC6268530]. The miRNA also influences cell proliferation and viability in mammary epithelial cells by targeting GHR gene expression; overexpression of bta-mir-15a reduces GHR and casein levels as well as cell viability, while inhibition of bta-mir-15a increases them [PMC6268530]. These findings suggest that bta-mir-15a plays a critical role in mammary gland development and lactation by regulating GHR mRNA and protein levels [PMC6268530], potentially affecting dairy cow productivity.

Literature search

17 open access papers mention bta-mir-15a
(31 sentences)

Sequence

20653 reads, 327 reads per million, 74 experiments

ccuuggaguaaagUAGCAGCACAUAAUGGUUUGUggauuuugaaaaggugcaggccauauugugcugccucaaaaauacaagg
(((((.......(..((((((((..((((((((((.............))))))))))..))))))))..).......)))))

Structure

     gaguaaa UA        UA          gauuu 
ccuug       g  GCAGCACA  AUGGUUUGUg     u
|||||       |  ||||||||  ||||||||||     g
ggaac       c  cgucgugu  uaccggacgu     a
     auaaaaa uc        ua          ggaaa 

Annotation confidence Not enough data

Genome context

chr12: 19660532-19660614 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from bta-mir-15a

Mature bta-miR-15a

• Accession: MIMAT0004334
• Description: Bos taurus bta-miR-15a mature miRNA
• Sequence: 14 - UAGCAGCACAUAAUGGUUUGU - 34
• Evidence: experimental ; cloned [1]

References

1. PubMed ID: 17306260
   Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland
   "Gu Z, Eleswarapu S, Jiang H"
   "FEBS Lett (2007) 581:981-988