bta-mir-15a is one of the 12 DA miRNAs identified in X and Y sperm [PMC7505075]. It is also one of the 123 mastitis-related miRNAs that are upregulated in cows with mastitis [PMC6107498]. The expression levels of bta-mir-15a and -15b are not significantly different between BLV-infected and uninfected cattle [PMC8432782]. In addition, bta-mir-15a is down-regulated in normalised data but not in un-normalised data [PMC3589390]. It has been suggested that bta-mir-15a may play a role in promoting lactation in mammary epithelial cells of dairy cows [PMC6268530]. The transfection of bta-mir-15a mimics/inhibitor into mammary epithelial cells has been shown to affect the expression of GHR protein and the synthesis of casein, but the mechanisms are still unknown [PMC6268530]. The regulatory relationship between bta-mir-15a and GHR needs to be confirmed [PMC6268530]. Transfection with bta-mir-15a mimics/inhibitor has been done using siPORT NeoFXTM Transfection Agent, with a final RNA concentration of 30 nM for bta-mir-15a mimics/inhibitor/negative control [PMC6268530'>PMC6268530'>PMC6268530]. Bovine miR-15a (bta-mir-15a) is located on bovine chromosome 12 between 18887743bp and 18887825bp [PMC6268530]. Bovine mammary epithelial cells transfected with bta-mir-15a mimics show reduced expression levels of GHR protein and casein, as well as decreased cell viability, while transfection with a bta-mir-15a inhibitor increases cell viability [PMC6268530]. The expression of GHR mRNA and protein is negatively regulated by bta-mir-15a [PMC6268530]. The expression of bta-mir-15a is regulated by DNA methylation and is positively correlated with the expression of its target gene CD163 [PMC6993440].
gaguaaa UA UA gauuu ccuug g GCAGCACA AUGGUUUGUg u ||||| | |||||||| |||||||||| g ggaac c cgucgugu uaccggacgu a auaaaaa uc ua ggaaa
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0004334 |
Description | Bos taurus bta-miR-15a mature miRNA |
Sequence | 14 - UAGCAGCACAUAAUGGUUUGU - 34 |
Evidence |
experimental
cloned [1] |
|