miRBase entry: hsa-mir-450b

Stem-loop hsa-mir-450b


Accession
MI0005531
Symbol
HGNC: MIR450B
Description
Homo sapiens hsa-mir-450b precursor miRNA
Gene family
MIPF0000128; mir-450

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR450B is a microRNA that has been identified as one of seven microRNAs in the blood that can predict ovarian cancer (OC) [PMC6701281]. It is part of a miRNA cluster that includes miR424-5p, miR424-3p, miR450a-1, miR450a-2, MIR450B, miR503, miR542-5p, and miR542-3p [PMC8396502]. In hepatitis E patients and healthy controls, MIR450B has been found to be specifically validated along with target genes MAPK1 and RNF20 [PMC5384411]. MIR450B is particularly associated with genes such as WASF2, PPMIF, SP110, IMP4, SERBP1, CREB3L2 and LDLR. It influences various cell types including CD8 cells, granulocytes monocytes dendritic cells and eosinophils. It also regulates pathways such as Interferon signaling pathway MYD88 signaling pathway cell proliferation pathway and cell death pathway [PMC5384411]. Additionally MIR450B has been found to inhibit the expression of Pax6 which promotes epidermal specification from SE cells [PMC4994084]. Overall MIR450B plays a role in predicting ovarian cancer and is associated with various genes and pathways involved in cell regulation.

Literature search
24 open access papers mention hsa-mir-450b
(40 sentences)

Sequence

7019 reads, 157 reads per million, 92 experiments
gcagaauuauUUUUGCAAUAUGUUCCUGAAUAuguaauauaaguguaUUGGGAUCAUUUUGCAUCCAUAguuuuguau
((((((((((...(((((.(((.((((((((((.........)))).)))))).))).)))))...))))))))))..

Structure
--          UUU     U   U      -    gua 
  gcagaauuau   UGCAA AUG UCCUGA AUAu   a
  ||||||||||   ||||| ||| |||||| ||||   u
  uguuuugAUA   ACGUU UAC AGGGUU ugug   a
ua          CCU     U   U      a    aau 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chrX: 134540185-134540262 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-450b
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-450b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-450b-5p

Accession MIMAT0004909
Description Homo sapiens hsa-miR-450b-5p mature miRNA
Sequence 11 - UUUUGCAAUAUGUUCCUGAAUA - 32
Evidence experimental
cloned [1]
Database links
Predicted targets

Mature hsa-miR-450b-3p

Accession MIMAT0004910
Description Homo sapiens hsa-miR-450b-3p mature miRNA
Sequence 48 - UUGGGAUCAUUUUGCAUCCAUA - 69
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414