WARNING: This summary was generated by AI. MIR450B is a microRNA implicated in various cellular processes and disease states [PMC5384411]. It is part of a cluster of microRNAs that includes miR424-5p, miR424-3p, miR450a-1, miR450a-2, and others [PMC8396502]. This microRNA has been identified as a potential biomarker in the blood for predicting ovarian cancer (OC) as part of a seven-microRNA pattern [PMC6701281]. In the context of hepatitis E patients, MIR450B has been associated with the regulation of target genes such as MAPK1 and RNF20 [PMC5384411]. It interacts with various genes that influence immune cells like CD8+ cells, granulocytes, monocytes, dendritic cells, and eosinophils and is involved in regulating pathways related to interferon response, MYD88 signaling as well as cell proliferation and cell death [PMC5384411]. Additionally, MIR450B plays a role in cellular differentiation by inhibiting the expression of Pax6 which promotes epidermal specification from SE cells [PMC4994084].
-- UUU U U - gua gcagaauuau UGCAA AUG UCCUGA AUAu a |||||||||| ||||| ||| |||||| |||| u uguuuugAUA ACGUU UAC AGGGUU ugug a ua CCU U U a aau
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004909 |
| Description | Homo sapiens hsa-miR-450b-5p mature miRNA |
| Sequence | 11 - UUUUGCAAUAUGUUCCUGAAUA - 32 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004910 |
| Description | Homo sapiens hsa-miR-450b-3p mature miRNA |
| Sequence | 48 - UUGGGAUCAUUUUGCAUCCAUA - 69 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|