MIR450B is a microRNA that has been identified as one of seven microRNAs in the blood that can predict ovarian cancer (OC) [PMC6701281]. It is part of a miRNA cluster that includes miR424-5p, miR424-3p, miR450a-1, miR450a-2, MIR450B, miR503, miR542-5p, and miR542-3p [PMC8396502]. In hepatitis E patients and healthy controls, MIR450B has been found to be specifically validated along with target genes MAPK1 and RNF20 [PMC5384411]. MIR450B is particularly associated with genes such as WASF2, PPMIF, SP110, IMP4, SERBP1, CREB3L2 and LDLR. It influences various cell types including CD8 cells, granulocytes monocytes dendritic cells and eosinophils. It also regulates pathways such as Interferon signaling pathway MYD88 signaling pathway cell proliferation pathway and cell death pathway [PMC5384411]. Additionally MIR450B has been found to inhibit the expression of Pax6 which promotes epidermal specification from SE cells [PMC4994084]. Overall MIR450B plays a role in predicting ovarian cancer and is associated with various genes and pathways involved in cell regulation.
-- UUU U U - gua gcagaauuau UGCAA AUG UCCUGA AUAu a |||||||||| ||||| ||| |||||| |||| u uguuuugAUA ACGUU UAC AGGGUU ugug a ua CCU U U a aau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004909 |
Description | Homo sapiens hsa-miR-450b-5p mature miRNA |
Sequence | 11 - UUUUGCAAUAUGUUCCUGAAUA - 32 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004910 |
Description | Homo sapiens hsa-miR-450b-3p mature miRNA |
Sequence | 48 - UUGGGAUCAUUUUGCAUCCAUA - 69 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
|