MIR889 is a miRNA that belongs to the miR655 miRNA cluster, which contains a total of 20 miRNAs [PMC7465874]. Nine of these miRNAs, including MIR889, have available expression data [PMC7465874]. In the context of HCV and chronic HCV complications, several upregulated miRNAs have been identified, including MIR889 [PMC9495750]. The expression data for the miR655 cluster reveals that it contains 16 miRNAs [PMC10148110]. Cancer cells have mechanisms to evade immune surveillance and tumor cell-derived extracellular vesicles (EVs) play a role in transmitting immune-suppressive messages in the tumor microenvironment [PMC10114864]. EV-incorporated RNAs can help cancer cells evade immune responses and convey death signals to immune cells [PMC10114864]. In colorectal cancer, EV-miR203 is involved in cellular immunosuppression by activating M2-tumor-associated macrophages [PMC10114864]. Additionally, MIR889 triggers the downregulation of immune infiltration in colorectal cancer [PMC10114864]. In a study on dogs, several highly differentially expressed (DE) miRNAs were identified, including MIR889 [PMC8376273]. Overall, MIR889 is a member of the miR655 cluster and has been implicated in various aspects of cancer biology and immunosuppression.
-- u g C UA A - uau gugcu aaa AAUGG UGUCCG GU UGGUC uc a ||||| ||| ||||| |||||| || ||||| || u uauga uuU UUACC ACAGGC UA AUUag ag u cc u G A UA - u uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004921 |
Description | Homo sapiens hsa-miR-889-3p mature miRNA |
Sequence | 49 - UUAAUAUCGGACAACCAUUGU - 69 |
Evidence |
experimental
cloned [1], Illumina [2] |
Database links | |
Predicted targets |
Accession | MIMAT0026719 |
Description | Homo sapiens hsa-miR-889-5p mature miRNA |
Sequence | 11 - AAUGGCUGUCCGUAGUAUGGUC - 32 |
Evidence |
experimental
Illumina [2] |
|