MIR889 is a microRNA (miRNA) that is part of the miR655 miRNA cluster, which includes a total of 20 miRNAs, with expression data available for nine of these, including MIR889 [PMC7465874]. This particular miRNA has been identified as upregulated in patients who developed hepatocellular carcinoma (HCC) in the context of hepatitis C virus (HCV) infections and chronic HCV complications [PMC9495750]. Additionally, MIR889 has been found to influence the expression of DAB2IP, which in turn can downregulate immune infiltration by B cells and CD8+ T cells within the colorectal cancer microenvironment [PMC10114864]. This suggests that MIR889 may play a role in immune evasion by cancer cells. Furthermore, MIR889 is one of the most differentially expressed (DE) miRNAs identified in a genomic region associated with disease conditions in dogs according to research mapping to the canine reference genome CanFam3.1 [PMC8376273].
-- u g C UA A - uau gugcu aaa AAUGG UGUCCG GU UGGUC uc a ||||| ||| ||||| |||||| || ||||| || u uauga uuU UUACC ACAGGC UA AUUag ag u cc u G A UA - u uau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004921 |
Description | Homo sapiens hsa-miR-889-3p mature miRNA |
Sequence | 49 - UUAAUAUCGGACAACCAUUGU - 69 |
Evidence |
experimental
cloned [1], Illumina [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0026719 |
Description | Homo sapiens hsa-miR-889-5p mature miRNA |
Sequence | 11 - AAUGGCUGUCCGUAGUAUGGUC - 32 |
Evidence |
experimental
Illumina [2] |
|