MIR876 is a gene that encodes two MicroRNAs, miR-876-3p and miR-876-5p [PMC3210160]. A bivariate GWAS study was conducted in Chinese and US Caucasians, focusing on femoral neck bone geometry and body lean mass, which are major risk factors for musculoskeletal disease [PMC3706967]. In Chinese individuals, MIR876 was found to be associated with bone geometry and ALM (appendicular lean mass), but these associations were not replicated in Caucasians [PMC3210160]. A group of 11 contiguous SNPs located within genomic regions containing MIR876 and MIR873 were strongly associated with ALM-BR (appendicular lean mass to body ratio) in Chinese individuals [PMC3210160]. The exact mechanisms by which MIR876 and MIR873 are involved in co-regulating bone and muscle metabolism remain unclear [PMC3210160'>PMC3210160]. In a bivariate GWAS for ALM and femoral neck bone geometry, 13 SNPs located within or near HK2, UMOD, MIR876, and MIR873 showed strong associations with both traits [PMC3210160]. Two of these SNPs were located in the promoter region of the MIR876 gene [PMC3210160]. Methylation-sensitive microRNAs including miR27A, miR-193a-5p (MIR193A), and miR-876-3p (MIR876) were also identified in the study [PMC9582525]. Additionally, pGBMs (primary glioblastomas) often exhibit a recurrent deletion on chromosome 9p21.3 that includes the MIR876 gene [PMC6388501].
U au uaa ugaagugcugUGGAUU CUUUGUGAAUCACCAu c g |||||||||||||||| |||||||||||||||| | c acuucgugauACUUAA GAAACAUUUGGUGGUg g u U gu uaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004924 |
Description | Homo sapiens hsa-miR-876-5p mature miRNA |
Sequence | 11 - UGGAUUUCUUUGUGAAUCACCA - 32 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004925 |
Description | Homo sapiens hsa-miR-876-3p mature miRNA |
Sequence | 50 - UGGUGGUUUACAAAGUAAUUCA - 71 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|