WARNING: This summary was generated by AI. Hsa-mir-147b is a microRNA that plays a significant role in the molecular landscape of rectum cancer, as its expression is characteristic of this malignancy [PMC10152154]. This microRNA's expression is negatively influenced by bile acids in the context of right-sided colon tumors, particularly when the CHRM3 gene is present [PMC10152154]. In a comparative study across different populations, hsa-mir-147b was identified as one of six effective microRNA pairings in India that are potentially involved in the interaction with viral SARS-CoV-2 miRNAs [PMC7395633]. This suggests that hsa-mir-147b may have broader implications beyond rectum cancer, possibly playing a role in viral interactions as well [PMC7395633].
-- u c A AACUAGAUu a ua aaau uagUGGAA CAUUUCUGCACA cugg || |||| |||||||| |||||||||||| |||| c au uuua AUCGUCUU GUAAAGGCGUGU Gacc gg u c C --------- a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0037331 |
| Description | Homo sapiens hsa-miR-147b-5p mature miRNA |
| Sequence | 12 - UGGAAACAUUUCUGCACAAACUAGAU - 37 |
| Evidence | not_experimental |
| Accession | MIMAT0004928 |
| Description | Homo sapiens hsa-miR-147b-3p mature miRNA |
| Sequence | 49 - GUGUGCGGAAAUGCUUCUGCUA - 70 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
|