Hsa-mir-147b is a microRNA that plays a significant role in the molecular landscape of rectum cancer, as its expression is characteristic of this malignancy [PMC10152154]. This microRNA's expression is negatively influenced by bile acids in the context of right-sided colon tumors, particularly when the CHRM3 gene is present [PMC10152154]. In a comparative study across different populations, hsa-mir-147b was identified as one of six effective microRNA pairings in India that are potentially involved in the interaction with viral SARS-CoV-2 miRNAs [PMC7395633]. This suggests that hsa-mir-147b may have broader implications beyond rectum cancer, possibly playing a role in viral interactions as well [PMC7395633].
-- u c A AACUagauu a ua aaau uagUGGAA CAUUUCUGCACA cugg || |||| |||||||| |||||||||||| |||| c au uuua aUCGUCUU GUAAAGGCGUGU Gacc gg u c C --------- a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004928 |
Description | Homo sapiens hsa-miR-147b-3p mature miRNA |
Sequence | 49 - GUGUGCGGAAAUGCUUCUGCU - 69 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0037331 |
Description | Homo sapiens hsa-miR-147b-5p mature miRNA |
Sequence | 12 - UGGAAACAUUUCUGCACAAACU - 33 |
Evidence | not_experimental |
|