WARNING: This summary was generated by AI. hsa-mir-190b, a microRNA, has been observed to play a regulatory role in the expression of FGF2, a fibroblast growth factor [PMC8923688]. It has been found to be upregulated, which in turn contributes to the downregulation of FGF2 [PMC8923688]. This regulatory action of hsa-mir-190b is significant as it helps in mitigating the inflammatory response and vascular endothelial injury [PMC8923688]. Additionally, hsa-mir-190b is involved in the activation of FGF2 and FGFR1 protein expression, which are critical components in vascular biology [PMC8923688]. However, it is important to note that hsa-mir-190b has also been identified as one of the most significantly downregulated microRNAs alongside hsa-miR-449a [PMC7499949]. This contrasting observation suggests that hsa-mir-190b may have complex regulatory roles that could vary depending on the cellular context or experimental conditions [PMC7499949; PMC8923688]..
- u -U G - aa ugcu cugug GAUAUGUUUGAUAUU GGUUG uuu u |||| ||||| ||||||||||||||| ||||| ||| acga gacau UUAUACAAACUGUAA UCAac aag u g c UC A c ga
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004929 |
| Description | Homo sapiens hsa-miR-190b-5p mature miRNA |
| Sequence | 11 - UGAUAUGUUUGAUAUUGGGUUG - 32 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0037332 |
| Description | Homo sapiens hsa-miR-190b-3p mature miRNA |
| Sequence | 48 - ACUAAAUGUCAAACAUAUUCU - 68 |
| Evidence | not_experimental |
|