WARNING: This summary was generated by AI. MIR744 is a non-conserved microRNA (miRNA) identified in a limited number of species and is involved in the post-transcriptional regulation of genes [PMC9879538]. It specifically regulates TGF-beta1, a protein that influences cellular proliferation, differentiation, migration, and survival [PMC3828615]. In the context of breast cancer (BC), MIR744 is hypomethylated and has been found to be up-regulated in 56% of cases [PMC3828615]. It has been shown that the drug bortezomib can induce the expression of MIR744 [PMC8308509]. In cervical cancer (CC), MIR744 is one of only six miRNAs expressed, suggesting a potential regulatory role in this cancer type as well [PMC4168028]. Additionally, MIR744 has been implicated in interactions with NONO protein and various other molecular components including miRNAs and protein-coding genes [PMC9730017]. Correlations between MIR744 expression and pulmonary vascular resistance (PVR) have been observed, indicating its potential as a biomarker for certain physiological parameters [PMC4357130]. Furthermore, MIR744 has been associated with the induction of Cyclin B1 expression in mouse cell lines and its expression levels have prognostic implications in nasopharyngeal carcinoma (NPC), with downregulation indicating poor prognosis [PMC4696257; PMC6368411].. Lastly, experimental manipulation of MIR744 levels can be achieved using constructs such as LVanti-MIR744 to inhibit its expression for research purposes [PMC5362436].
-- c GC C - U gucuuacugaa c uuggg aaggU GGGG UAG GGC AACAGCA gguuuc ||||| ||||| |||| ||| ||| ||||||| |||||| u ggcuc uUCCA CUCC AUC CCG UUGUCgu ccaaag cu a -A A A - ----acacgca g
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004945 |
| Description | Homo sapiens hsa-miR-744-5p mature miRNA |
| Sequence | 11 - UGCGGGGCUAGGGCUAACAGCA - 32 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004946 |
| Description | Homo sapiens hsa-miR-744-3p mature miRNA |
| Sequence | 68 - CUGUUGCCACUAACCUCAACCU - 89 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|