miRBase entry: hsa-mir-744

Stem-loop hsa-mir-744


Accession
MI0005559
Symbol
HGNC: MIR744
Description
Homo sapiens hsa-mir-744 precursor miRNA mir-744
Gene
family?
RF00936; mir-744

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR744 is a non-conserved microRNA (miRNA) identified in a limited number of species and is involved in the post-transcriptional regulation of genes [PMC9879538]. It specifically regulates TGF-beta1, a protein that influences cellular proliferation, differentiation, migration, and survival [PMC3828615]. In the context of breast cancer (BC), MIR744 is hypomethylated and has been found to be up-regulated in 56% of cases [PMC3828615]. It has been shown that the drug bortezomib can induce the expression of MIR744 [PMC8308509]. In cervical cancer (CC), MIR744 is one of only six miRNAs expressed, suggesting a potential regulatory role in this cancer type as well [PMC4168028]. Additionally, MIR744 has been implicated in interactions with NONO protein and various other molecular components including miRNAs and protein-coding genes [PMC9730017]. Correlations between MIR744 expression and pulmonary vascular resistance (PVR) have been observed, indicating its potential as a biomarker for certain physiological parameters [PMC4357130]. Furthermore, MIR744 has been associated with the induction of Cyclin B1 expression in mouse cell lines and its expression levels have prognostic implications in nasopharyngeal carcinoma (NPC), with downregulation indicating poor prognosis [PMC4696257; PMC6368411].. Lastly, experimental manipulation of MIR744 levels can be achieved using constructs such as LVanti-MIR744 to inhibit its expression for research purposes [PMC5362436].

Literature search
127 open access papers mention hsa-mir-744
(693 sentences)

Sequence

495656 reads, 936.0 reads per million, 188 experiments
uugggcaaggUGCGGGGCUAGGGCUAACAGCAgucuuacugaagguuuccuggaaaccacgcacaugCUGUUGCCACUAACCUCAACCUuacucgguc
(((((.(((((..((((.((((((.(((((((...........((((((...)))))).......)))))))))).))).)))).))))).)))))..

Structure
--     c     GC    C   -   U       gucuuacugaa      c 
  uuggg aaggU  GGGG UAG GGC AACAGCA           gguuuc  
  ||||| |||||  |||| ||| ||| |||||||           |||||| u
  ggcuc uUCCA  CUCC AUC CCG UUGUCgu           ccaaag  
cu     a     -A    A   A   -       ----acacgca      g 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr17: 12081899-12081996 [+]

Disease association
hsa-mir-744 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-744-5p

Accession MIMAT0004945
Description Homo sapiens hsa-miR-744-5p mature miRNA
Sequence 11 - UGCGGGGCUAGGGCUAACAGCA - 32
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-744-3p

Accession MIMAT0004946
Description Homo sapiens hsa-miR-744-3p mature miRNA
Sequence 68 - CUGUUGCCACUAACCUCAACCU - 89
Evidence experimental
cloned [2]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298