hsa-mir-877 is a microRNA that has been implicated in various biological processes and diseases, including acting as an oncogene in gastric cancer [PMC7794682]. It is one of the most abundant miRNAs associated with high-density lipoprotein (HDL) in normal subjects, which suggests a potential role in lipid metabolism or cardiovascular health [PMC3074610]. Additionally, hsa-mir-877 has been identified as upregulated in nonresponder samples of both lung squamous cell carcinoma (LUSC) and head and neck squamous cell carcinoma (HNSC), suggesting a possible involvement in cancer progression or response to therapy [PMC7794682]. Interestingly, hsa-mir-877 is listed among both upregulated and downregulated miRNAs across various studies, indicating complex regulatory roles that may be context-dependent [PMC6921333]. However, it has not been confirmed as a potential endogenous control gene for expression studies due to its relatively uniform expression among candidate reference genes, as other genes were found to be more uniformly expressed [PMC3531299].
-GUA AU C C g caaagac c GAGGAG GG G AGGGgacacg g uuggggguuc |||||| || | |||||||||| | |||||||||| u CUCCUC CC C UCUCCUgugu c gacucccagg GACC -- U U g ------a g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004949 |
Description | Homo sapiens hsa-miR-877-5p mature miRNA |
Sequence | 1 - GUAGAGGAGAUGGCGCAGGG - 20 |
Evidence |
experimental
cloned [1-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004950 |
Description | Homo sapiens hsa-miR-877-3p mature miRNA |
Sequence | 66 - UCCUCUUCUCCCUCCUCCCAG - 86 |
Evidence |
experimental
cloned [1-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|