MIR665 is a microRNA that has been implicated in various biological processes and diseases. It is a downstream miRNA with high affinity to circ_0087207 and is inhibited by circ_0087207 to regulate DNA damage/repair and apoptosis [PMC9027941]. MIR665 has been shown to target genes involved in growth retardation and postnatal lethality, such as Col5a1, Clip2, and Pcgf2 [PMC5886287]. In colonic mucosal tissues, MIR665 has been found to target Xbp1 and promote apoptosis and colitis [PMC6031203]. It has also been shown to inhibit cell growth in various cancer types, including prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 has been identified as a suppressor of E2F3 mRNA by binding to its 3'-UTR region [PMC9701882]. In breast cancer, MIR665 is upregulated by COX-2 overexpression along with miR526b [PMC5762661]. Overall, MIR665 plays a significant role in regulating gene expression involved in DNA damage/repair, apoptosis, growth retardation, postnatal lethality, colitis promotion, and oncogenesis.
-u u -c u -acc - c c ccu gaggggucuc gccucu ca gga u | ||| |||||||||| |||||| || ||| g gga cUCCCCGGAG CGGAGG gu cuu c cg c ca U ACCA a u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004952 |
Description | Homo sapiens hsa-miR-665 mature miRNA |
Sequence | 43 - ACCAGGAGGCUGAGGCCCCU - 62 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|