Stem-loop hsa-mir-665

Accession

MI0005563

Symbol

HGNC: MIR665

Description

Homo sapiens hsa-mir-665 precursor miRNA mir-665

Gene
family

RF00921; mir-665

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR665 is a microRNA that has been implicated in various biological processes and diseases. It is a downstream miRNA with high affinity to circ_0087207 and is inhibited by circ_0087207 to regulate DNA damage/repair and apoptosis [PMC9027941]. MIR665 has been shown to target genes involved in growth retardation and postnatal lethality, such as Col5a1, Clip2, and Pcgf2 [PMC5886287]. In colonic mucosal tissues, MIR665 has been found to target Xbp1 and promote apoptosis and colitis [PMC6031203]. It has also been shown to inhibit cell growth in various cancer types, including prostate cancer and gastrointestinal stromal tumors [PMC6438025]. Furthermore, MIR665 has been identified as a suppressor of E2F3 mRNA by binding to its 3'-UTR region [PMC9701882]. In breast cancer, MIR665 is upregulated by COX-2 overexpression along with miR526b [PMC5762661]. Overall, MIR665 plays a significant role in regulating gene expression involved in DNA damage/repair, apoptosis, growth retardation, postnatal lethality, colitis promotion, and oncogenesis.

Literature search

18 open access papers mention hsa-mir-665
(36 sentences)

Sequence

533 reads, 26 reads per million, 64 experiments

ucuccucgaggggucucugccucuacccaggacucuuucaugACCAGGAGGCUGAGGCCCCUcacaggcggc
.(.(((.((((((((((.((((((...(((((....))).))....)))))).))))))))))..))).)..

Structure

-u u   -c          u      -acc  -   c 
  c ccu  gaggggucuc gccucu    ca gga u
  | |||  |||||||||| ||||||    || |||  
  g gga  cUCCCCGGAG CGGAGG    gu cuu c
cg c   ca          U      ACCA  a   u 

Annotation confidence Not enough data

Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context

chr14: 100875033-100875104 [+]

Clustered miRNAs

7 other miRNAs are < 10 kb from hsa-mir-665

Disease association

hsa-mir-665 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-665

• Accession: MIMAT0004952
• Description: Homo sapiens hsa-miR-665 mature miRNA
• Sequence: 43 - ACCAGGAGGCUGAGGCCCCU - 62
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298